View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850_low_51 (Length: 315)
Name: NF7850_low_51
Description: NF7850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 16 - 244
Target Start/End: Complemental strand, 34433243 - 34433015
Alignment:
| Q |
16 |
atttcaacactcgtaaacaccaatcaagctgaaatcggtgcagatggaattaatcgattggagagtggggattgaaggggtgaggaaatcgaattggata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34433243 |
atttcaacactcgtaaacaccaatcaagctgaaatcggtgcagatggaattaatcgattggagagtggggattgaaggggtgaggaaatcgaattggata |
34433144 |
T |
|
| Q |
116 |
ttgaatttggaggaaatggaagaatttgaaaccctaatttgaaagagaaggaggttttgaggaagagagtgatgaatgaatgtgaaaattacgcacaaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34433143 |
ttgaatttggaggaaatggaagaatttgaaaccctaatttgaaagagaaagaggttttgaggaagagagcgatgaatgaatgtgaaaattacgcacaaaa |
34433044 |
T |
|
| Q |
216 |
caagaacaagacaaagaagagaaatgtga |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34433043 |
caagaacaagacaaagaagagaaatgtga |
34433015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University