View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850_low_58 (Length: 296)
Name: NF7850_low_58
Description: NF7850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850_low_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 16 - 285
Target Start/End: Original strand, 34573475 - 34573747
Alignment:
| Q |
16 |
agatagatagtaaagtataattaggttcaagacttagagtt-aagaggg-aacttaggccaaagaaaagcacccatagcaaactctcttttgtaa-gcca |
112 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34573475 |
agatagatggtaaagtataattaggttcaagactttgagtttaagaggggaacttaggccaaagaaaagcacccatagcaaactctcttttgtaaagcca |
34573574 |
T |
|
| Q |
113 |
aatcaccatgtgtaggcaacccatattccttaaggagcccatcaagcttccattcaggcatgtcgtggtagtctttctcagtgtatcttggataatgaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34573575 |
aatcaccatgtgtaggcaacccatattccttaaggagcccatcaagcttccattcaggcatgtcttggtagtctttctcagtgtatcttggataatgaag |
34573674 |
T |
|
| Q |
213 |
aggcatttgaaagaagctaacattattcttttttggactctccattctctgataatgatcttttctcaatatt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34573675 |
aggcatttgaaagaagctaacattattcttttttggactctccattctctgataatgatcttttctcaatatt |
34573747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University