View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850_low_64 (Length: 274)
Name: NF7850_low_64
Description: NF7850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 3 - 258
Target Start/End: Complemental strand, 7958443 - 7958188
Alignment:
| Q |
3 |
gatgaagcattaacaggttttcttttgagtaaacttgtttcttgacccaagatactactctctggtgatgaattatcagacctatgaacaactctagtgt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7958443 |
gatgaagcattaacaggttttcttttgagtaaacttgtttcttgacccaagatactactctctggtgatgaattatcagacctatgaacaactctagtgt |
7958344 |
T |
 |
| Q |
103 |
ttccatgaacaacatctctaaagctacaaatggagctacaagaagaacctaattttgagtaaccattaatattgtttggttttgaaggatcatgaactct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
7958343 |
ttccatgaacaacatctctaaagctacaaatggagctacaagaagaacctaattttgagtaaccattattgttgtttggttttgaaggatcatgaactct |
7958244 |
T |
 |
| Q |
203 |
tgaaacttcgatctgtttgcatgttaggaggttttttatttggtcccatgaagaag |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7958243 |
tgaaacttcgatctgtttgcatgttaggaggttttttatttggtcccatgaagaag |
7958188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University