View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850_low_66 (Length: 272)
Name: NF7850_low_66
Description: NF7850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 15 - 254
Target Start/End: Original strand, 37217177 - 37217416
Alignment:
| Q |
15 |
acatcaagtcctcttaagagaacgcatatttacctcgttatcttggaaatgatttaagtggcttttggaagttctagtacttttgctacccttctgattt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37217177 |
acatcaagtcctcttaagagaacgcatatttacctcgttatcttggaaatgatttaagtggcttttggaagttctagtacttttgctacacttctgattt |
37217276 |
T |
 |
| Q |
115 |
tctccttcaaaccatctatgataagattccaagtacatattcaacaaggggaaaagtgtgagtatacttgagaaataaggtcgggtgtctcaaatgaatg |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37217277 |
tctccttcaaaccatctatgataaggttccaagtacatattcaacaaggggaaaagtgtgagtatacttgagaaataaggtcgggtgtctcaaatgaatg |
37217376 |
T |
 |
| Q |
215 |
aagggactgaaatctggattttcagttttgggactgtact |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37217377 |
aagggactgaaatctggattttcagttttgggacagtact |
37217416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University