View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850_low_81 (Length: 234)
Name: NF7850_low_81
Description: NF7850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850_low_81 |
 |  |
|
| [»] chr2 (167 HSPs) |
 |  |
|
| [»] chr1 (193 HSPs) |
 |  |
|
| [»] chr3 (205 HSPs) |
 |  |
|
| [»] chr7 (171 HSPs) |
 |  |
|
| [»] chr6 (131 HSPs) |
 |  |
|
| [»] chr5 (158 HSPs) |
 |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |
|
| [»] chr4 (199 HSPs) |
 |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |
|
| [»] scaffold0105 (2 HSPs) |
 |  |  |
|
| [»] scaffold0684 (2 HSPs) |
 |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |
|
| [»] scaffold0176 (2 HSPs) |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |
|
| [»] scaffold0011 (2 HSPs) |
 |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 2e-26; HSPs: 172)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 20 - 179
Target Start/End: Original strand, 41694833 - 41694993
Alignment:
| Q |
20 |
aggagtaaccaaagaaggtgaagcgatgaaactgtatcaaa-cttatccaaataaaacagaagatcttatgaaaggagaaaaaaccaaaatgttcaaatt |
118 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||| | || ||||| ||||| |||| | ||| |||||||| ||| ||| ||||||||| |
|
|
| T |
41694833 |
aggagtaaccaaagaagctgaagcgatgacactgtatcaaaacaaattcaaatcaaacaaaagagcctatagaaggagaaccaactaaattgttcaaata |
41694932 |
T |
 |
| Q |
119 |
tgtctttaatgtgaactctccacaaacaaattatgagtattatatgtactcatcacattat |
179 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||| ||||| | |||||||||||||| |
|
|
| T |
41694933 |
tgtctttaatgataactcttcacaaacaaattatgagcattatctccactcatcacattat |
41694993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 1525805 - 1525857
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1525805 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1525857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 32418314 - 32418366
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32418314 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32418366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 10872912 - 10872963
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10872912 |
aaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
10872963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 27341594 - 27341543
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27341594 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
27341543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 43477160 - 43477211
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43477160 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
43477211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 4474046 - 4473996
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4474046 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
4473996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 14239082 - 14239032
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14239082 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14239032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 14495067 - 14495117
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14495067 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14495117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 22917562 - 22917612
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22917562 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22917612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 24187567 - 24187617
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24187567 |
aaggctaaaatatggttttaatccctgcaaatatgcttcgttttggtttta |
24187617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 14238746 - 14238799
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14238746 |
taaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
14238799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 19494414 - 19494365
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19494365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 1685110 - 1685162
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1685110 |
aaaaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1685162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4017304 - 4017252
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
4017304 |
aaaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
4017252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 4375692 - 4375740
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4375740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 10776499 - 10776451
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10776451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 16789369 - 16789321
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16789321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29488114 - 29488062
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
29488114 |
aaaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
29488062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 37536082 - 37536134
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37536082 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
37536134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 4016906 - 4016953
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4016953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 11976370 - 11976421
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11976370 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
11976421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 40066494 - 40066545
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
40066494 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
40066545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 7272418 - 7272468
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
7272418 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
7272468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 16644046 - 16643996
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
16644046 |
aaggctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
16643996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 16789073 - 16789123
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
16789073 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
16789123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 21125717 - 21125767
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21125717 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
21125767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 25131109 - 25131159
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
25131109 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
25131159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 28346392 - 28346442
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28346392 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28346442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 34963298 - 34963348
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34963298 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
34963348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 38930666 - 38930616
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38930666 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
38930616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 1526173 - 1526124
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
1526173 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
1526124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 184 - 233
Target Start/End: Complemental strand, 3680803 - 3680754
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
3680803 |
aaggctaaaatatgattttgatccctgcaaatatgcctcgttttggtttt |
3680754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 4710221 - 4710172
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4710221 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
4710172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 8094842 - 8094793
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
8094842 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
8094793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 11019858 - 11019809
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11019858 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
11019809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 16643660 - 16643709
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
16643660 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
16643709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 18549200 - 18549249
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
18549200 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
18549249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 19494118 - 19494167
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
19494118 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19494167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 24955011 - 24954962
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
24955011 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
24954962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 28346759 - 28346710
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28346759 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28346710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 29158353 - 29158402
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
29158353 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29158402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 32726272 - 32726223
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32726272 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
32726223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 33526413 - 33526364
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33526413 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
33526364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 33636321 - 33636370
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
33636321 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
33636370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35143845 - 35143796
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
35143845 |
aggctaaaatatggttttaatccgtgtaaatatgcctcgttttggtttta |
35143796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35345618 - 35345569
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
35345618 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
35345569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 2728597 - 2728549
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2728549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 6146953 - 6146901
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
6146953 |
aaaaagctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
6146901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 7272751 - 7272703
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggtttta |
7272703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 7326421 - 7326373
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
7326373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7420226 - 7420278
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
7420226 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
7420278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 10755528 - 10755480
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10755480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20277688 - 20277740
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
20277688 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
20277740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 21064315 - 21064367
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
21064315 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
21064367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24187901 - 24187849
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
24187901 |
aaaaggctaaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
24187849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 25131447 - 25131399
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
25131399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 29158669 - 29158621
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggtttta |
29158621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 35097692 - 35097644
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35097644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 40066820 - 40066772
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggtttta |
40066772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 40844156 - 40844204
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
40844204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 6146517 - 6146564
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
6146564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 8298978 - 8298927
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
8298978 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8298927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 14488713 - 14488764
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
14488713 |
aaaggctaaaatatagttttagtccctgaaaatatgcctcgttttggtttta |
14488764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 20984143 - 20984194
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
20984143 |
aaaggctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
20984194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 22650461 - 22650512
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
22650461 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
22650512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 24090487 - 24090440
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24090440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 25600223 - 25600278
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
25600223 |
tttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25600278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 32725904 - 32725955
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
32725904 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
32725955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 1408355 - 1408305
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
1408355 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttagtttta |
1408305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 2811783 - 2811733
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
2811783 |
aaggttaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
2811733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 7420592 - 7420542
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
7420592 |
aaggctaaaatatggttttggtcactgcaaatatgcctcgttttggtttta |
7420542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 9496725 - 9496675
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
9496725 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
9496675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 10540784 - 10540734
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
10540784 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
10540734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 11019518 - 11019568
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
11019518 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
11019568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 13779151 - 13779197
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
13779197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 14496814 - 14496864
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
14496814 |
aaggctaaaatatggttttagttcctgcaaatatgcgtcgttttggtttta |
14496864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 27117979 - 27117929
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
27117979 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttt |
27117929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 28323847 - 28323897
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
28323847 |
aaggctaaaatatggttgtagtccctgcaaatatgcttcgttttggtttta |
28323897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 38930300 - 38930350
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
38930300 |
aaggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
38930350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 3511905 - 3511954
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
3511905 |
aggctaaaatatggttttggtcccttcaaatatgcctcgttttggtttta |
3511954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 3512267 - 3512218
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3512267 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3512218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 5357422 - 5357471
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
5357422 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
5357471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 6469279 - 6469328
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
6469279 |
aggctaaaatatggctttcgtccctgcaaatatgcctcgttttggtttta |
6469328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 7326085 - 7326134
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
7326085 |
aggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttta |
7326134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 8094478 - 8094527
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
8094478 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttggtttta |
8094527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 9496340 - 9496389
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
9496340 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
9496389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 10337118 - 10337167
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10337118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10337167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 10337450 - 10337401
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
10337450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
10337401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 13154885 - 13154934
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
13154885 |
aggctaaaatatagttttgatccttgcaaatatgcctcgttttggtttta |
13154934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 14847820 - 14847873
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
14847820 |
taaaaggttaaaatatgattttgatccctgcaaatatgcctcattttggtttta |
14847873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 20278058 - 20278009
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
20278058 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggtttta |
20278009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 21064685 - 21064636
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
21064685 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggtttta |
21064636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 28258242 - 28258193
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
28258242 |
aggctaaaatatggttttaacctctgcaaatatgtctcgttttggtttta |
28258193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 35097327 - 35097376
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35097327 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35097376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35346999 - 35346950
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35346999 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35346950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 40492959 - 40493008
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
40492959 |
aggctaaaatatggttttagtacctgcaaatatgtctcgttttggtttta |
40493008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtt |
231 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 1162909 - 1162957
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgatttta |
1162957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 1778564 - 1778612
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
1778612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 4621354 - 4621306
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
4621306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 7186004 - 7185956
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
7185956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 8298587 - 8298635
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8298635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 10873280 - 10873232
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggtttta |
10873232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 13232562 - 13232514
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
13232514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 14489073 - 14489025
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
14489025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 14495389 - 14495342
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggtttta |
14495342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 15719656 - 15719704
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggtttta |
15719704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 28497251 - 28497303
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
28497251 |
aaaaggctaaaatatgattttggtccctgcaaatatgcctcgttttagtttta |
28497303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 184 - 232
Target Start/End: Complemental strand, 30337219 - 30337171
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| ||||||||||||| |
|
|
| T |
30337219 |
aaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 31445467 - 31445415
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
31445467 |
aaaaggctaaaatatagttttgatccctacaaatatgcctcattttggtttta |
31445415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 33526052 - 33526100
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggtttta |
33526100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 34963664 - 34963616
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
34963616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 35115640 - 35115592
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||||||||||||||| |
|
|
| T |
35115640 |
aggctaaaatatggttttagtccctacaaatatacctcgttttggtttt |
35115592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 35346629 - 35346677
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35346677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 37536419 - 37536371
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
37536371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 42132864 - 42132912
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42132912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 42133154 - 42133106
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42133106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 2728229 - 2728280
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
2728229 |
aaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
2728280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 13779531 - 13779484
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggtttta |
13779484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 20984513 - 20984462
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
20984513 |
aaaggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
20984462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 40844538 - 40844487
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
40844538 |
aaaggttaaaatatggttttagtccctgcaaatatatctcgttttggtttta |
40844487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 44997928 - 44997979
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||| ||||| |
|
|
| T |
44997928 |
aaaggctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
44997979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 234
Target Start/End: Complemental strand, 5357773 - 5357715
Alignment:
| Q |
176 |
ttatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| ||| ||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5357773 |
ttatttgaaacgctaaaatatgattttggtccctgcaaatatgcttcgttttggtttta |
5357715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 228
Target Start/End: Original strand, 9908918 - 9908960
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttg |
228 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
9908918 |
ggctaaaatatagttttaatccctgcaaatatgtctcgttttg |
9908960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 18549571 - 18549525
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggtttta |
18549525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 226
Target Start/End: Complemental strand, 4376011 - 4375970
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttt |
226 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
4376011 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttt |
4375970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 4473703 - 4473752
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
4473703 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
4473752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 9175368 - 9175323
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
9175323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 10540448 - 10540497
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||||||||||||||| |
|
|
| T |
10540448 |
aggctaaaatattgttttggtctctgcaaatatgcctcgttttggtttta |
10540497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 11976733 - 11976688
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
11976688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 13155252 - 13155203
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
13155252 |
aggctaaaatatggtttttgttcctgcaaatatgtctcgttttggtttta |
13155203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 13232201 - 13232246
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13232246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 17073806 - 17073855
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
17073806 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
17073855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 17574464 - 17574415
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
17574464 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
17574415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 25600606 - 25600549
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||| ||||| |||||||||||||| || |||||||||||| |
|
|
| T |
25600606 |
tattaaaaaggctaaaatatagttttggtccctgcaaatatgtcttgttttggtttta |
25600549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 27117752 - 27117801
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
27117752 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgatttta |
27117801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 27341257 - 27341306
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
27341257 |
aggctaaaatatggttttaactcctgcaaatatgccttgttttgatttta |
27341306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 28399036 - 28398987
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
28399036 |
aggctaaaatatgattttagtccctgcaaatatggttcgttttggtttta |
28398987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 28497616 - 28497571
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
28497571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 29992301 - 29992252
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
29992301 |
aggctcaaatatggttttgttccctgcaaatatgcctcgttttgatttta |
29992252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 33652193 - 33652238
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagtttta |
33652238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 1163274 - 1163226
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||| |||||| |||||| |
|
|
| T |
1163274 |
ggctaaaatatggttttagtccatgcaaatatgccccgttttagtttta |
1163226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 1408005 - 1408053
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||| |||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagtttta |
1408053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 222
Target Start/End: Original strand, 28398756 - 28398792
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctc |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28398756 |
ggctaaaatatggttttagtccctgcaaatatgcctc |
28398792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 42430120 - 42430072
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
42430072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 44998263 - 44998215
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||| || |||||||| ||||||||||||||| |
|
|
| T |
44998263 |
ggctaaaatatggttttgatctctacaaatatgtctcgttttggtttta |
44998215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 191 - 234
Target Start/End: Original strand, 3680532 - 3680575
Alignment:
| Q |
191 |
aaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggtttta |
3680575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 7578527 - 7578480
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
7578527 |
gctaaaatacggttttaattcctgcaaatatgactcattttggtttta |
7578480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 9175009 - 9175060
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
9175009 |
aaaggctaaaatatgattttggtccttgcaaatatgtctcgttttggtttta |
9175060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 23939913 - 23939862
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||| || |||||||||||| |||||||||| |||| |
|
|
| T |
23939913 |
aaaggttaaaatatggttttgattcctgcaaatatgactcgttttggcttta |
23939862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 191 - 234
Target Start/End: Original strand, 24814710 - 24814753
Alignment:
| Q |
191 |
aaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggtttta |
24814753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 29991912 - 29991963
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||| || |||||||||||||||||||| |||||| |
|
|
| T |
29991912 |
aaaggttaaaatatggttttggtctctgcaaatatgcctcgttttagtttta |
29991963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 2355885 - 2355935
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| | ||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
2355885 |
aaggctaaaatataggtttgatccctgcaaatataccttgttttggtttta |
2355935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 227
Target Start/End: Original strand, 25702511 - 25702553
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgtttt |
227 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
25702511 |
aggctaaaatatggttttggtccctgtaaatatgcctcgtttt |
25702553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 26530666 - 26530716
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| ||||||||||||| ||| |||||||||||||| |||| |||||| |
|
|
| T |
26530666 |
aaggcttaaatatggttttagtccatgcaaatatgcctcattttagtttta |
26530716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 28324183 - 28324133
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || |||||||||||| |
|
|
| T |
28324183 |
aaggctaaaatatggttttggtccctacaaatatgtcttgttttggtttta |
28324133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 43727097 - 43727143
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | |||||| ||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgatttta |
43727143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 43727431 - 43727386
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggtttta |
43727386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 13796593 - 13796548
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
13796593 |
taaaatatggtttggatccctgcaaatatgtctcattttggtttta |
13796548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 14848186 - 14848142
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| ||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
14848186 |
taaaatatgattttaatcc-tgcaaatatgtctcgttttggtttta |
14848142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 19962994 - 19963043
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||| |||||||| |||||| |
|
|
| T |
19962994 |
aggctaaaatatggtgttagtccttgcaaatatgtctcgttttagtttta |
19963043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 21126022 - 21125973
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||||| ||| || ||||||| ||||||||||||||| |
|
|
| T |
21126022 |
aggctaaaatatagttttagtccatgtaaatatgactcgttttggtttta |
21125973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 24815069 - 24815020
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggtttta |
24815020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 32040074 - 32040123
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| | ||| |||||||||||||| |||||||||||||| |
|
|
| T |
32040074 |
aggctaaaatatgatcttagtccctgcaaatatgtttcgttttggtttta |
32040123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 21509919 - 21509883
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcct |
221 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
21509919 |
aggctaaaatatgattttagtccctgcaaatatgcct |
21509883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 23939547 - 23939595
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| || ||||||||||| |||||||| |||||| |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttagtttta |
23939595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 29487750 - 29487798
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggtttta |
29487798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 30969717 - 30969681
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctc |
222 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatgcctc |
30969681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Complemental strand, 42430041 - 42430013
Alignment:
| Q |
205 |
tccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42430041 |
tccctgcaaatatgcctcgttttggtttt |
42430013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 167)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8046325 - 8046377
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8046325 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
8046377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 4042605 - 4042658
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4042605 |
taaaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
4042658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 26814233 - 26814181
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26814233 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
26814181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 234
Target Start/End: Complemental strand, 16900217 - 16900158
Alignment:
| Q |
175 |
attatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16900217 |
attattgataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16900158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 234
Target Start/End: Complemental strand, 16993608 - 16993549
Alignment:
| Q |
175 |
attatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16993608 |
attattgataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16993549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 24483894 - 24483843
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24483894 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24483843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 37271736 - 37271787
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37271736 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37271787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 38980256 - 38980205
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38980256 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
38980205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 17541778 - 17541728
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17541778 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
17541728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 19184153 - 19184103
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19184153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19184103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 22881611 - 22881661
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22881611 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22881661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 24358947 - 24358897
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24358947 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
24358897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 33732860 - 33732910
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33732860 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33732910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 37272104 - 37272054
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37272104 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37272054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 44994067 - 44994013
Alignment:
| Q |
180 |
ttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
44994067 |
ttaaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttagtttta |
44994013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 27310873 - 27310922
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27310873 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 43788857 - 43788906
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43788857 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
43788906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 44985985 - 44985936
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44985985 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
44985936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 11713849 - 11713797
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11713849 |
aaaaggctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
11713797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 31226077 - 31226029
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggtttta |
31226029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 33733241 - 33733193
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33733193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 42696211 - 42696155
Alignment:
| Q |
178 |
atttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42696211 |
attttaaaagctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
42696155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 10374775 - 10374822
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10374822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 17541379 - 17541430
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
17541379 |
aaaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttta |
17541430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 19183779 - 19183830
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
19183779 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19183830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 2481559 - 2481509
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2481559 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2481509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 4423893 - 4423943
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4423893 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
4423943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 14003744 - 14003694
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14003744 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
14003694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 15842825 - 15842775
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15842825 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
15842775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 16522989 - 16523039
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16522989 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16523039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 16523331 - 16523277
Alignment:
| Q |
180 |
ttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16523331 |
ttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16523277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 29859874 - 29859824
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29859874 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29859824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 32476093 - 32476143
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
32476093 |
aaggctaaaatatggttttgatccctgcaaatatgcctcattttggtttta |
32476143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 38731827 - 38731877
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38731827 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
38731877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 42358697 - 42358747
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42358697 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
42358747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 44073809 - 44073759
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
44073809 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
44073759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 44985623 - 44985669
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44985669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 173 - 234
Target Start/End: Original strand, 3837920 - 3837981
Alignment:
| Q |
173 |
acattatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
3837920 |
acattatttacaaggctaaaatatagttttagtccctgcaaatatgtctcgttttcgtttta |
3837981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 9195207 - 9195158
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9195207 |
aggctaaaatatggttttagaccctgcaaatatgcctcgttttggtttta |
9195158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 10671942 - 10671893
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10671942 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10671893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 11788417 - 11788368
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
11788417 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
11788368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 23989837 - 23989886
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23989837 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
23989886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 24358615 - 24358664
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24358615 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24358664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 25705450 - 25705401
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25705450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25705401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 26707872 - 26707921
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
26707872 |
aggctaaaatatggttttaatccctgcaaatatacttcgttttggtttta |
26707921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 27311070 - 27311021
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
27311070 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
27311021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 30215417 - 30215470
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
30215417 |
taaaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
30215470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 33575751 - 33575800
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
33575751 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
33575800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 38639411 - 38639460
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
38639411 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
38639460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 40301970 - 40302023
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
40301970 |
taaaaggctaaaatatggttttagtccctgcaaatatgcctcattttagtttta |
40302023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 40302340 - 40302291
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
40302340 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
40302291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 43592045 - 43592094
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
43592045 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
43592094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 43597153 - 43597202
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
43597153 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
43597202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 3671192 - 3671144
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3671144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 4794130 - 4794178
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
4794178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 5334751 - 5334799
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5334799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 5335040 - 5334992
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5334992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 5790558 - 5790606
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggtttta |
5790606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 5790899 - 5790851
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
5790851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 8046648 - 8046600
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
8046600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 9195054 - 9195102
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
9195102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 10375069 - 10375021
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10375021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 11713485 - 11713533
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
11713533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 18113081 - 18113137
Alignment:
| Q |
178 |
atttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
18113081 |
atttataaggctaaaatatggttttggtccctgcaaatatgcctagttttggtttta |
18113137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 20131681 - 20131633
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20131633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 20658410 - 20658362
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
20658410 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25705081 - 25705133
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
25705081 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25705133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 26813866 - 26813914
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26813914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 36622250 - 36622298
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
36622298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 36622588 - 36622536
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
36622588 |
aaaagactaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
36622536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 41694003 - 41693955
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
41693955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 3838263 - 3838216
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
3838216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 29865222 - 29865269
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
29865269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 31644838 - 31644889
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31644838 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
31644889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 41451830 - 41451885
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
41451830 |
tttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
41451885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 41693671 - 41693722
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
41693671 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
41693722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 146328 - 146374
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
146374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 1497943 - 1497897
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggtttta |
1497897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 4424187 - 4424137
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4424187 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
4424137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 7814244 - 7814294
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
7814244 |
aaggctaaaatattgttttagtccctgtaaatatgcctcgttttggtttta |
7814294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 23732332 - 23732282
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
23732332 |
aaaaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
23732282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 31225713 - 31225763
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
31225713 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
31225763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 33576119 - 33576069
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
33576119 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
33576069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 37911122 - 37911072
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
37911122 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
37911072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 41791312 - 41791266
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
41791266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 43789194 - 43789144
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
43789194 |
aaggctaaaatatggttttagttcctgcaaatatgcttcgttttggtttta |
43789144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 188 - 233
Target Start/End: Original strand, 1137983 - 1138028
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
1138028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 1138360 - 1138311
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
1138360 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttagtttta |
1138311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 3671002 - 3671051
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
3671002 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgatttta |
3671051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 7814738 - 7814689
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
7814738 |
aggctaaaatatgattttagtccctgcaaatatgcctcattttggtttta |
7814689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 13215059 - 13215108
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13215059 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13215108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 14003408 - 14003457
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14003408 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
14003457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 15842464 - 15842509
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
15842509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 16673772 - 16673723
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
16673772 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgtttta |
16673723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 17912808 - 17912763
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
17912763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 20131316 - 20131365
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
20131316 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
20131365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 20658060 - 20658109
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
20658060 |
aggctaaaacatggttttagtccctgcaaatatgccttgttttggtttta |
20658109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 26238808 - 26238861
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
26238808 |
taaaaggttaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
26238861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 26239161 - 26239112
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
26239161 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
26239112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 29859490 - 29859535
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29859535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 29865512 - 29865463
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
29865512 |
aggctaaaatatggttttagtccttgcaaatatgcttcgttttggtttta |
29865463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 32691312 - 32691361
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
32691312 |
aggctaaaatatggttttagtttctgcaaatatgcctcgttttggtttta |
32691361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 40786459 - 40786508
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
40786459 |
aggctaaaatatggttttattcactgcaaatatgtctcgttttggtttta |
40786508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 44559061 - 44559110
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
44559061 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
44559110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 1497610 - 1497658
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgatttta |
1497658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3172016 - 3172068
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
3172016 |
aaaaggctaaaatatgattttggtccctgcaaatatgcctcattttggtttta |
3172068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3172536 - 3172484
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
3172536 |
aaaaggctaaaatatgattttggtccttgcaaatatgcctcgttttggtttta |
3172484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 12835325 - 12835373
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggtttta |
12835373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 23732039 - 23732087
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggtttta |
23732087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 27109073 - 27109121
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggtttta |
27109121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 184 - 232
Target Start/End: Original strand, 29831812 - 29831860
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
29831812 |
aaggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt |
29831860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 31326256 - 31326204
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||| ||| ||||||||||||||||||| |||||| |
|
|
| T |
31326256 |
aaaaggctaaaatatagttttagtccttgcaaatatgcctcgttttagtttta |
31326204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 34317798 - 34317846
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
34317846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 37228729 - 37228781
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
37228729 |
aaaaggctaaaatatggttttggtccctgcaaatatgtatcgttttggtttta |
37228781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 40124966 - 40125014
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
40125014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 42695868 - 42695916
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42695916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 228
Target Start/End: Original strand, 10664983 - 10665026
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttg |
228 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
10664983 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
10665026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 10665297 - 10665246
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||| || |||||||||||| |||||||||||||| |
|
|
| T |
10665297 |
aaaggctaaaatatagttttagtctctgcaaatatgcatcgttttggtttta |
10665246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 16673408 - 16673459
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
16673408 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
16673459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 20939324 - 20939277
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
20939277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 24483401 - 24483448
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggtttta |
24483448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 25954112 - 25954163
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
25954112 |
aaaggctaaaatatgtttttagtccctgcaaatatgtttcgttttggtttta |
25954163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 227
Target Start/End: Complemental strand, 32691645 - 32691594
Alignment:
| Q |
176 |
ttatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgtttt |
227 |
Q |
| |
|
||||| |||||||||||| ||||||||| |||||||||||||| |||||||| |
|
|
| T |
32691645 |
ttattgaaaaggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 2265399 - 2265349
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
2265399 |
aaggctaaaatatgattttagtccttgcaaatatgtctcgttttggtttta |
2265349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 16968550 - 16968600
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
16968550 |
aaggttaaaatatggttttagtccctacaaatatgccttgttttggtttta |
16968600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 17302145 - 17302095
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
17302145 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggtttta |
17302095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 25954428 - 25954378
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
25954428 |
aaggttaaaatatggttttagtccttgcaaatatgcctcgttttgatttta |
25954378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 29182440 - 29182394
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggtttta |
29182394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 192 - 234
Target Start/End: Original strand, 35155298 - 35155340
Alignment:
| Q |
192 |
aatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggtttta |
35155340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 36815837 - 36815787
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
36815837 |
aaggctaaaatatggttttggtccatgcaaatatgtctcgttttggtttta |
36815787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 41791020 - 41791066
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggtttta |
41791066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 43597501 - 43597451
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
43597501 |
aaggctaaaatatgattttagtccctgctaatatgtctcgttttggtttta |
43597451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 43671932 - 43671982
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
43671932 |
aaggctaaaatatggtttttgtccctgtaaatatgcttcgttttggtttta |
43671982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 43710710 - 43710660
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
43710710 |
aaggctaaaatatgattttagcccttgcaaatatgcctcgttttggtttta |
43710660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 44559407 - 44559361
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
44559361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 45442698 - 45442648
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
45442698 |
aaggctaaaatatgattttagtccttgcaaatatgtctcgttttggtttta |
45442648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 10671629 - 10671678
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
10671629 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggtttta |
10671678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 17912452 - 17912497
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
17912497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 23990193 - 23990148
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
23990148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 31909479 - 31909431
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
31909479 |
aggctaaaatatggttttggtccctgcaaatatgcctc-ttttggtttta |
31909431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 35686335 - 35686290
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
35686335 |
taaaatatggttttgatccctgtaaatatgcttcgttttggtttta |
35686290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 37910755 - 37910804
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| |||| |||||| |
|
|
| T |
37910755 |
aggctaaaatatggttttgatccttgcaaatatgcctcattttagtttta |
37910804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||| ||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 146690 - 146642
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
146642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 4042890 - 4042842
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggtttta |
4042842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 13215366 - 13215318
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
13215366 |
aggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 18113454 - 18113406
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggtttta |
18113406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 31325920 - 31325968
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| ||||||| |||||| |
|
|
| T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagtttta |
31325968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 34318083 - 34318035
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgatttta |
34318035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 34964159 - 34964111
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagtttta |
34964111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 190 - 234
Target Start/End: Complemental strand, 36806892 - 36806848
Alignment:
| Q |
190 |
aaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
36806848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 2481190 - 2481241
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||| ||||||||||||||| |
|
|
| T |
2481190 |
aaaggctaaaatatggttttggtacttgcaaatatgtctcgttttggtttta |
2481241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 199 - 234
Target Start/End: Complemental strand, 16900135 - 16900100
Alignment:
| Q |
199 |
ttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16900135 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16900100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 199 - 234
Target Start/End: Complemental strand, 16993526 - 16993491
Alignment:
| Q |
199 |
ttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16993526 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16993491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 13802484 - 13802534
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| | | || |||||| |||||||||||||||| |
|
|
| T |
13802484 |
aaggctaaaatatggttttagttcttgtaaatattcctcgttttggtttta |
13802534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 40125291 - 40125241
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |||| |||||| |
|
|
| T |
40125291 |
aaggctaaaatatgattttggtccctgcaaatatgcctcatttttgtttta |
40125241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 1295544 - 1295499
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggtttta |
1295499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 3832634 - 3832589
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
3832589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 13850521 - 13850570
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||| |||| |||||||||| |
|
|
| T |
13850521 |
aggctaaaatatagttttgatctctgcaaatatgtctcgatttggtttta |
13850570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 13850881 - 13850836
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggtttta |
13850836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 230
Target Start/End: Original strand, 26709695 - 26709740
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
230 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||| ||||||||||| |
|
|
| T |
26709695 |
aggctaaaatatgattttagttcctgcaaatatgtctcgttttggt |
26709740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 30215872 - 30215823
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | ||||||||||||| |
|
|
| T |
30215872 |
aggctaaaatatggttttggtccctgcaaatatatcgcgttttggtttta |
30215823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35155624 - 35155571
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| || |||||| ||||| |
|
|
| T |
35155624 |
taaaaggctaaaatatggttttggtccctgaaaatatgtcttgttttgatttta |
35155571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 38979889 - 38979938
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatat-gcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggtttta |
38979938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 214
Target Start/End: Complemental strand, 29311632 - 29311600
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaa |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
29311632 |
aaaaggctaaaatatggttttagtccctgcaaa |
29311600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Original strand, 29831891 - 29831919
Alignment:
| Q |
205 |
tccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29831891 |
tccctgcaaatatgcctcgttttggtttt |
29831919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 38231431 - 38231479
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||| |||||| ||||| |
|
|
| T |
38231431 |
ggctaaaatatgattttgatccctgcaaatataccttgttttgatttta |
38231479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 193)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 52254180 - 52254231
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52254180 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
52254231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 19623019 - 19622969
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19623019 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
19622969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 29688430 - 29688380
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29688430 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
29688380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 33379884 - 33379936
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33379884 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33379936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 45368486 - 45368538
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45368486 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
45368538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 1810924 - 1810975
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1810924 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1810975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 11822001 - 11822052
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11822001 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
11822052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 26061949 - 26062004
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26061949 |
tttagaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
26062004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 18473597 - 18473547
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18473597 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18473547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 29072495 - 29072545
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29072495 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29072545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 32729051 - 32729001
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32729051 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32729001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 35307713 - 35307763
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35307713 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35307763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 38164301 - 38164247
Alignment:
| Q |
180 |
ttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38164301 |
ttaaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38164247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 990380 - 990331
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
990380 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
990331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 3753581 - 3753524
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
3753581 |
tattttaaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
3753524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 7819104 - 7819055
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7819104 |
aggctaaaatatggttttaatctctgcaaatatgcctcgttttggtttta |
7819055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 13770488 - 13770537
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13770488 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
13770537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 18302388 - 18302339
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18302339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 18473271 - 18473320
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18473271 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18473320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 22919683 - 22919732
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22919683 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22919732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 33045695 - 33045642
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33045695 |
taaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
33045642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35005745 - 35005696
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35005745 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35005696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 41358368 - 41358417
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
41358417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 47819605 - 47819548
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47819605 |
tattttaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
47819548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3679622 - 3679674
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
3679622 |
aaaaggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
3679674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 7001897 - 7001849
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7001849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 24507479 - 24507527
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
24507527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24507847 - 24507795
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24507847 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24507795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 24649350 - 24649398
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24649398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 32626525 - 32626577
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
32626525 |
aaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
32626577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35005440 - 35005492
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
35005440 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
35005492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 35308111 - 35308063
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35308063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 46868577 - 46868529
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
46868529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 191 - 234
Target Start/End: Original strand, 2939934 - 2939977
Alignment:
| Q |
191 |
aaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggtttta |
2939977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 3753214 - 3753261
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3753261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 234
Target Start/End: Complemental strand, 32454305 - 32454246
Alignment:
| Q |
175 |
attatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
32454305 |
attatttattaggctaaaatatggttttagtccctgcaaatatgcctcgttttggcttta |
32454246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 44641079 - 44641126
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44641126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 45290454 - 45290505
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
45290454 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
45290505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 990086 - 990136
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
990086 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
990136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 6567498 - 6567448
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6567498 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
6567448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 12361009 - 12361059
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
12361009 |
aaggctaaaatatggttttagtccctgcaaatttgcctcgttttggtttta |
12361059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 17984331 - 17984381
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
17984331 |
aaggctaaaatatggtttgagtccctgcaaatatgcctcgttttggtttta |
17984381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 26442901 - 26442851
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
26442901 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
26442851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 31258337 - 31258387
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
31258337 |
aaggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
31258387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 13260322 - 13260273
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13260322 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13260273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 14007488 - 14007537
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
14007537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 183 - 228
Target Start/End: Complemental strand, 18079663 - 18079618
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttg |
228 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18079663 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 19622654 - 19622703
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
19622654 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19622703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 21391095 - 21391144
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
21391095 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
21391144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 30322924 - 30322977
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
30322924 |
taaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
30322977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 37624744 - 37624793
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
37624744 |
aaggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt |
37624793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 41358664 - 41358615
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
41358664 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
41358615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 45290821 - 45290772
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
45290821 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttta |
45290772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 47819231 - 47819280
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47819231 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
47819280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 48609595 - 48609546
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
48609595 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
48609546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 48955713 - 48955762
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48955713 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
48955762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 50429210 - 50429161
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50429210 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
50429161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 50799129 - 50799178
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
50799129 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
50799178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3247194 - 3247246
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3247194 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3247246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 10631532 - 10631480
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10631532 |
aaaaggctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
10631480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 15058770 - 15058718
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
15058770 |
aaaaggctaaaatattgttttgatccctgcaaatatgtctcgttttggtttta |
15058718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 17984701 - 17984653
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
17984653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19720708 - 19720760
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
19720708 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19720760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 22953556 - 22953508
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22953508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 24653802 - 24653850
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24653850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 26191359 - 26191407
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
26191407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 26191734 - 26191686
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26191686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 26442563 - 26442611
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26442611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 29072862 - 29072814
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggtttta |
29072814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 33234542 - 33234594
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
33234542 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
33234594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 34002944 - 34002892
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
34002944 |
aaaaggctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
34002892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 37545628 - 37545676
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
37545676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 38151212 - 38151164
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38151164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44158046 - 44157994
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
44158046 |
aaaaggctaaaatatggtttttgtccctgcaaatatgcctagttttggtttta |
44157994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 44641432 - 44641384
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
44641384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 48609232 - 48609284
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
48609232 |
aaaaggctaaaatatggttttagtcccggcaaatatgtctcgttttggtttta |
48609284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 48956066 - 48956018
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
48956018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 52254479 - 52254431
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
52254431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 4323829 - 4323876
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
4323876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 7818783 - 7818830
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
7818830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 24654170 - 24654119
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
24654170 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
24654119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 33000672 - 33000621
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
33000672 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
33000621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 44157696 - 44157743
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
44157743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 177 - 234
Target Start/End: Original strand, 292852 - 292907
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
292852 |
tatttaaaaggctaaaat--ggttttagtccctgcaaatatgcctcgttttgctttta |
292907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 8140801 - 8140751
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
8140801 |
aaggctaaaatatggttttggtacctgcaaatatgcctcgttttggtttta |
8140751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 12360970 - 12360920
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
12360970 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12360920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 15526364 - 15526314
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
15526364 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
15526314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 17129691 - 17129737
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggtttta |
17129737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 18899837 - 18899887
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
18899837 |
aaggttaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
18899887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 234
Target Start/End: Original strand, 26324575 - 26324633
Alignment:
| Q |
176 |
ttatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| | ||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
26324575 |
ttattttataggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
26324633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 31061153 - 31061103
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31061153 |
aaggctaaaatatggttttgatccctgcaaatatatctcgttttggtttta |
31061103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 38163929 - 38163979
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38163929 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38163979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 41881091 - 41881141
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
41881091 |
aaggctaaaatatggttttagtccctccaaatatgtctcgttttggtttta |
41881141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 3247559 - 3247514
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3247514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 8140433 - 8140482
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
8140433 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8140482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 10887599 - 10887550
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10887599 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10887550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 11822366 - 11822317
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
11822366 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgctttta |
11822317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 13259987 - 13260036
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
13259987 |
aggctaaaatatggttttagtcgctgcaaatatggctcgttttggtttta |
13260036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 15334916 - 15334965
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
15334916 |
aggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta |
15334965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 15335292 - 15335247
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
15335247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 15516581 - 15516630
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
15516581 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggtttta |
15516630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 16026939 - 16026890
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
16026939 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16026890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 18900130 - 18900085
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggtttta |
18900085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 22919978 - 22919929
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||| |||||| |
|
|
| T |
22919978 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttagtttta |
22919929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 24649661 - 24649612
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
24649661 |
aggccaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
24649612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 228
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 26324948 - 26324899
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
26324948 |
aggctaaaatatgattttagtccatgcaaatatgcctcgttttggtttta |
26324899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 30323294 - 30323245
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
30323294 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
30323245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 31258699 - 31258654
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgtttta |
31258654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35056895 - 35056846
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
35056895 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
35056846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 39747836 - 39747787
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
39747836 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
39747787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 45380271 - 45380320
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
45380271 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45380320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 45638895 - 45638846
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
45638895 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 3679986 - 3679938
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgatttta |
3679938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 10631164 - 10631212
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10631212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 12158690 - 12158738
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggtttta |
12158738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 12322970 - 12322922
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12322922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 16060885 - 16060837
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16060837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 24977778 - 24977826
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
24977826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 27521572 - 27521624
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
27521572 |
aaaaagctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
27521624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 33000305 - 33000353
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
33000353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 185 - 233
Target Start/End: Original strand, 33067347 - 33067395
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
33067347 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt |
33067395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 35056530 - 35056578
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35056578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 38136981 - 38136933
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
38136933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 38150844 - 38150896
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
38150844 |
aaaaggttaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
38150896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 40718110 - 40718158
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
40718158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 45380636 - 45380588
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
45380588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 45638580 - 45638628
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
45638628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 15058419 - 15058466
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggtttta |
15058466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 15211508 - 15211559
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
15211508 |
aaaggctaaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
15211559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 16060593 - 16060643
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
16060593 |
aaaggctaaaatatggttttggtccct-caaatatgcctcgttttggtttta |
16060643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 17130086 - 17130035
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
17130086 |
aaagactaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 21391377 - 21391326
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
21391377 |
aaaggttaaaatatggttttagtccctgtaaatatgcctcgttttagtttta |
21391326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 39303675 - 39303722
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| ||||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggtttta |
39303722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 49073688 - 49073739
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
49073688 |
aaaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
49073739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 4360628 - 4360578
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
4360628 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttggggtttta |
4360578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 4789310 - 4789356
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
4789356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 7350421 - 7350471
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
7350421 |
aaggttaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
7350471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 8364614 - 8364664
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
8364614 |
aaggttaaaatatggttttgatccctgcaaatatgtttcgttttggtttta |
8364664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 12360597 - 12360651
Alignment:
| Q |
180 |
ttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
12360597 |
ttaataggctaaaatatggttttggtccctgcaaatatgcctcattttagtttta |
12360651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 15211858 - 15211812
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
15211812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 16083045 - 16083095
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| |||||||| |||||| |
|
|
| T |
16083045 |
aaggctaaaatatggttttagtccccgcaaatatgtctcgtttttgtttta |
16083095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 45368847 - 45368801
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| ||||| || ||||||||||||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggtttta |
45368801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 46183686 - 46183732
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
46183732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 7867128 - 7867177
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||| |||||| |
|
|
| T |
7867128 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagtttta |
7867177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 10887232 - 10887281
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
10887232 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
10887281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 19721071 - 19721026
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
19721026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 21383103 - 21383152
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
21383103 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggtttta |
21383152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 21383429 - 21383380
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
21383429 |
aggctaaaatatagttttaatccttgcaaatatgcctcattttgatttta |
21383380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 26142419 - 26142468
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||||| || | ||||||||||||||||||||||||| |
|
|
| T |
26142419 |
aggctaaaatatagttttactctccgcaaatatgcctcgttttggtttta |
26142468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 33045354 - 33045403
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
33045354 |
aggctaaaatttggttttggtccctgcaaatatgcctagttttggtttta |
33045403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 34382942 - 34382987
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttt |
226 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
34382942 |
taaaatgctaaaatatggttttagtccctgcaaatatacctcgttt |
34382987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 34808200 - 34808245
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggtttta |
34808245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 42482978 - 42483027
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
42482978 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
42483027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 233
Target Start/End: Complemental strand, 42483273 - 42483224
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
42483273 |
aaggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 46868221 - 46868274
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
46868221 |
taaaaggctaaattatgattttagtccctgcaaatatgcttcattttggtttta |
46868274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 50428872 - 50428921
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||| ||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgctttta |
50428921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 12322604 - 12322652
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgatttta |
12322652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18079394 - 18079446
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
18079394 |
aaaaggctaaaatacggttttggtccttgcaaatatgcctcattttggtttta |
18079446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 25658014 - 25658062
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
25658062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 26062262 - 26062210
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| ||||||||||||||| |||||| ||||||| ||| ||||||||||| |
|
|
| T |
26062262 |
aaaaggttaaaatatggttttagtccctgtaaatatgtctcattttggtttta |
26062210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 26207274 - 26207326
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
26207274 |
aaaagactaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
26207326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 31060787 - 31060835
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggtttta |
31060835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 33234912 - 33234864
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| ||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
33234864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 39025381 - 39025334
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggtttta |
39025334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 41738796 - 41738844
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagtttta |
41738844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 5058995 - 5058944
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
5058995 |
aaaggttaaaatatggttttggtccctggaaatatgcctcgttttgatttta |
5058944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 16026570 - 16026621
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16026570 |
aaaggctaaaatataattttggtccctgcaaatatccctcgttttggtttta |
16026621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 191 - 234
Target Start/End: Complemental strand, 16083394 - 16083351
Alignment:
| Q |
191 |
aaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgatttta |
16083351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 19198948 - 19198901
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||||| ||||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgctttta |
19198901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 24978125 - 24978074
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
24978125 |
aaaggctaaaatatagttttggtcctggcaaatatgcctcgttttggtttta |
24978074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 25658304 - 25658253
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
25658304 |
aaagactaaaatattcttttgatccctgcaaatatgcctcgttttgatttta |
25658253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 32420099 - 32420146
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
32420146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 33067729 - 33067682
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 34002631 - 34002682
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
34002631 |
aaaaggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 228
Target Start/End: Original strand, 36912852 - 36912895
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttg |
228 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
36912852 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 41739121 - 41739075
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
41739121 |
aggctaaaatatggttttagtccctgcaaatat---tcgttttggtttta |
41739075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 7867359 - 7867309
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
7867359 |
aaggctaaaatatggttttggtccctgcaaatatgtcttattttggtttta |
7867309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 20756017 - 20756067
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||| ||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
20756017 |
aaggttaaaatatgattttaatccttgtaaatatgtctcgttttggtttta |
20756067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 234
Target Start/End: Original strand, 32035442 - 32035484
Alignment:
| Q |
192 |
aatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
32035442 |
aatatggttttgatctctgcaaatatgtctcgttttggtttta |
32035484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 48730615 - 48730569
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||| |||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgtttta |
48730569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 7350733 - 7350688
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| || |||||||||| |||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggtttta |
7350688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 22674202 - 22674251
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
22674202 |
aggctaaaatatggtttaggtccatgcaaatatgtctcgttttggtttta |
22674251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 33380257 - 33380208
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccc-tgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||||||||| |
|
|
| T |
33380257 |
ggctaaaatatggttttagccccctacaaatatgcctcgttttggtttta |
33380208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 39025107 - 39025156
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
39025107 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
39025156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 227
Target Start/End: Complemental strand, 4565343 - 4565295
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgtttt |
227 |
Q |
| |
|
||||| |||||||||||||||| | |||||||||||||| |||||||| |
|
|
| T |
4565343 |
tttaataggctaaaatatggttctggtccctgcaaatatgtctcgtttt |
4565295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Complemental strand, 7350657 - 7350629
Alignment:
| Q |
205 |
tccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7350657 |
tccctgcaaatatgcctcgttttggtttt |
7350629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 8364917 - 8364869
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
8364917 |
aggctaaaatatagttttggtccccgcaaatatgtctcgttttggtttt |
8364869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 20948755 - 20948803
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||| ||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggtttta |
20948803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 24510308 - 24510260
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
24510308 |
ggctaaaatatggttttggtccctgcaaatatggttcgttttagtttta |
24510260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Original strand, 28507194 - 28507222
Alignment:
| Q |
205 |
tccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28507194 |
tccctgcaaatatgcctcgttttggtttt |
28507222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 37625026 - 37624982
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtt |
231 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| ||||||||||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggtt |
37624982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 40718474 - 40718426
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | |||||| ||||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatgcatagttttgatttta |
40718426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 205)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 46751269 - 46751319
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46751269 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
46751319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 39288899 - 39288850
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39288899 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
39288850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 43441608 - 43441555
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43441608 |
taaaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
43441555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 4950033 - 4950085
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4950033 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4950085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 10977345 - 10977293
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10977345 |
aaaaggctaaaatatggatttaatccctgcaaatatgcctcgttttggtttta |
10977293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 37507226 - 37507174
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37507226 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37507174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 40979714 - 40979662
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40979714 |
aaaaggctaaaatatggttttaatccctgcaaatatggctcgttttggtttta |
40979662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 26799881 - 26799936
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
26799881 |
tttaaaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
26799936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 4513261 - 4513311
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4513261 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4513311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 20612900 - 20612850
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20612900 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
20612850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 28427610 - 28427560
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28427610 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28427560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 39437111 - 39437061
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39437111 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
39437061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 51834606 - 51834656
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51834606 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
51834656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 3151749 - 3151798
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3151749 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3151798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 3152112 - 3152063
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3152112 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3152063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 3830517 - 3830468
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3830517 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3830468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 9603628 - 9603677
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9603628 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
9603677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 15286155 - 15286204
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggtttta |
15286204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 21159818 - 21159769
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21159818 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
21159769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 34238928 - 34238867
Alignment:
| Q |
173 |
acattatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
34238928 |
acattaattaaaaggctaaaatatggttttagtccccgcaaatatgcttcgttttggtttta |
34238867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 37506866 - 37506915
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37506866 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37506915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 10976978 - 10977026
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10977026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13584371 - 13584319
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
13584371 |
aaaaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
13584319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14633541 - 14633593
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14633541 |
aaaagactaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14633593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 25710870 - 25710822
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25710822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31480132 - 31480184
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31480132 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
31480184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 40169340 - 40169392
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
40169340 |
aaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttta |
40169392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 54608514 - 54608566
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54608514 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
54608566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 22156292 - 22156245
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22156245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 25615972 - 25616023
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25615972 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25616023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 39436715 - 39436766
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
39436715 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
39436766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 45002014 - 45002069
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45002014 |
tttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
45002069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 46186774 - 46186723
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
46186774 |
aaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
46186723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 4513622 - 4513572
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4513622 |
aaggctaaaatatggttttactccctgcaaatatgtctcgttttggtttta |
4513572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 4814538 - 4814588
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4814538 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 5345691 - 5345641
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5345691 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
5345641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 20611018 - 20611068
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
20611018 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
20611068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 22008524 - 22008574
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
22008524 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22008574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 22016042 - 22016092
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
22016042 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22016092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 28942907 - 28942857
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
28942907 |
aaggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
28942857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 30268503 - 30268553
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30268503 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
30268553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 39288571 - 39288621
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
39288571 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
39288621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 45320981 - 45320931
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45320981 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
45320931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 50196301 - 50196347
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
50196347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 3387609 - 3387556
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
3387609 |
taaaaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggtttta |
3387556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 3830133 - 3830182
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
3830133 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
3830182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 9262156 - 9262107
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9262156 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
9262107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 12673639 - 12673692
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
12673639 |
taaaaggctaaaatatagttttagtccctgtaaatatgcctcgttttggtttta |
12673692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 20907454 - 20907409
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggtttta |
20907409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 28552384 - 28552335
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28552384 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28552335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 28942524 - 28942573
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
28942524 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
28942573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 29955667 - 29955618
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29955667 |
aggcttaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29955618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 30004822 - 30004773
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30004822 |
aggcttaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30004773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 30130157 - 30130206
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
30130157 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
30130206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 34238597 - 34238646
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
34238597 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
34238646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 45002394 - 45002337
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
45002394 |
tattaaaaaggctaaaatatggttttggtctctgcaaatatgcctcgttttggtttta |
45002337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 51500686 - 51500637
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
51500637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 51550081 - 51550130
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51550081 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
51550130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 51834943 - 51834894
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
51834943 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
51834894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 8510214 - 8510262
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggtttta |
8510262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 9863404 - 9863356
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
9863356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 12741275 - 12741223
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
12741275 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12741223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 15016388 - 15016436
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
15016436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 16123139 - 16123187
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
16123187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 21159449 - 21159501
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
21159449 |
aaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
21159501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 22008890 - 22008842
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
22008842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 29445954 - 29446002
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
29446002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 32119588 - 32119536
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
32119588 |
aaaaggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
32119536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 40370589 - 40370541
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
40370541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 44802282 - 44802330
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggtttta |
44802330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 49323782 - 49323830
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
49323830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 53701663 - 53701615
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
53701615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 3361817 - 3361770
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
3361770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 8940528 - 8940477
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8940528 |
aaaggttaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
8940477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 19656538 - 19656589
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
19656538 |
aaaggctaaaatatggttttagtccatgcaaatatgcctcgttttgatttta |
19656589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 19844584 - 19844533
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
19844584 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
19844533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 35565505 - 35565556
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
35565505 |
aaaggctaaaatatggttttgttccctgcaaatatacctcgttttggtttta |
35565556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 51760117 - 51760070
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
51760070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 474042 - 474092
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
474042 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
474092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 1721454 - 1721404
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
1721454 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
1721404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 3387263 - 3387313
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
3387263 |
aaggttaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
3387313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 7518088 - 7518138
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
7518088 |
aaggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgtttta |
7518138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 7518444 - 7518398
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggtttta |
7518398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 9597097 - 9597047
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
9597097 |
aaggctaaaatatggttttgttccctgcaaatatgcttcgttttggtttta |
9597047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 14772209 - 14772259
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14772209 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
14772259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 21553887 - 21553937
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
21553887 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
21553937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 29525103 - 29525153
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
29525103 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttagtttta |
29525153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 29955300 - 29955346
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
29955346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 30004454 - 30004500
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
30004500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 31869596 - 31869642
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggtttta |
31869642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 45006247 - 45006201
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
45006201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 47336226 - 47336276
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
47336226 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
47336276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 48924242 - 48924192
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
48924242 |
aaggctaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
48924192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 52342585 - 52342535
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
52342585 |
aaggctaaaatatggtttttgtctctgcaaatatgcctcgttttggtttta |
52342535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 275443 - 275492
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||| ||||| |
|
|
| T |
275443 |
aggctaaaatatggttttagtccctgcaactatgcctcgttttgatttta |
275492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 474409 - 474360
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
474409 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
474360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 9603920 - 9603871
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
9603920 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 11463227 - 11463280
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
11463227 |
taaaaagctaaaatatggttttggttcctgcaaatatgcctcgttttggtttta |
11463280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 12740906 - 12740955
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
12740906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12740955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 20757403 - 20757448
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
20757448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 20757776 - 20757727
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
20757776 |
aggctaaaatatgattttaatccctgtaaatatgcatcgttttggtttta |
20757727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 22155928 - 22155977
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
22155928 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
22155977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 183 - 228
Target Start/End: Original strand, 25353196 - 25353241
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttg |
228 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25353196 |
aaaggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 28427244 - 28427293
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
28427244 |
aggctaaaatatggttttagttcctgcaaatatgtctcgttttggtttta |
28427293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 28552020 - 28552069
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
28552020 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgtttta |
28552069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 29446207 - 29446158
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
29446207 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
29446158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 29490744 - 29490695
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
29490744 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
29490695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 30106221 - 30106172
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
30106221 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggtttta |
30106172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 31869957 - 31869908
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
31869957 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagtttta |
31869908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 35177250 - 35177303
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35177250 |
taaaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
35177303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 47005520 - 47005471
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
47005520 |
aggctaaaatatggttttggtccctgcaaatattcctcgttttggtttta |
47005471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 47336582 - 47336533
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
47336582 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
47336533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 50196658 - 50196609
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
50196658 |
aggctaaaatatggttttagtccctacaaatatgcctcgtttttgtttta |
50196609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 51550447 - 51550398
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
51550447 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
51550398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 52342194 - 52342243
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
52342194 |
aggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 54608864 - 54608815
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
54608864 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
54608815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 4034717 - 4034765
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
4034765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 4035053 - 4035005
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
4035005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8940156 - 8940208
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| |||||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
8940156 |
aaaaggttaaaatatggttttgatctctgcaaatatacctcgttttggtttta |
8940208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 9261789 - 9261837
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
9261837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 15979338 - 15979386
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
15979386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 26089730 - 26089778
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
26089778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 26090078 - 26090030
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
26090030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 30552482 - 30552430
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
30552482 |
aaaaggctaaaatatcgttttagtccatgcaaatatgtctcgttttggtttta |
30552430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 31480500 - 31480452
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggtttta |
31480452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 39072213 - 39072165
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgatttta |
39072165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 40169654 - 40169606
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
40169606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 43441270 - 43441318
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
43441318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 46186405 - 46186457
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
46186405 |
aaaatgctaaaatatgattttagtccctgcaaatatgcctcgttttgatttta |
46186457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 51759815 - 51759867
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||| ||||||||||||||| |
|
|
| T |
51759815 |
aaaaggctaaaatatggttctagttcctgcaaatatgtctcgttttggtttta |
51759867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 14633892 - 14633841
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
14633892 |
aaaggctaaattatggttttagtccctgcaaatatgtcttgttttggtttta |
14633841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 25610129 - 25610082
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
25610082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 40277819 - 40277870
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
40277819 |
aaaggctaaaatgtggttttggtccctgcaaatatgcttcgttttggtttta |
40277870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 43440492 - 43440543
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| |||||||| |||||| |
|
|
| T |
43440492 |
aaaggctaaaatatggttttagtccttgcaaatatgtctcgttttagtttta |
43440543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 230
Target Start/End: Complemental strand, 44802551 - 44802504
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
230 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||||||||||| |
|
|
| T |
44802551 |
aaaggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 47114484 - 47114535
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
47114484 |
aaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
47114535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 53113439 - 53113490
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
53113439 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 2486900 - 2486854
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
2486854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 4814900 - 4814851
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
4814900 |
aaggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggtttta |
4814851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 30130506 - 30130456
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| ||||||||||||| || ||||||||||||||| ||||||||||| |
|
|
| T |
30130506 |
aaggctcaaatatggttttagtcactgcaaatatgcctcattttggtttta |
30130456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 35569138 - 35569088
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35569138 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35569088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 43440785 - 43440739
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggtttta |
43440739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 47005152 - 47005202
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
47005152 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttagtttta |
47005202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 7588317 - 7588366
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
7588317 |
aggctaaaatatagttttggtccctgcaaatatgccttgttttggtttta |
7588366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 9863050 - 9863094
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgcaa-tatgcctcgttttggtttta |
9863094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 15979702 - 15979653
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
15979702 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
15979653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 25710509 - 25710558
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
25710509 |
aggctcaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
25710558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 27681683 - 27681634
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| | || ||||||||||||||||||||||||||| |
|
|
| T |
27681683 |
aggctaaaatatggttctggtctctgcaaatatgcctcgttttggtttta |
27681634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 28452377 - 28452328
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
28452377 |
aggctaaaatatggttttggtccctacaaatatgcttcgttttggtttta |
28452328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 101 - 150
Target Start/End: Complemental strand, 29555597 - 29555548
Alignment:
| Q |
101 |
aaccaaaatgttcaaatttgtctttaatgtgaactctccacaaacaaatt |
150 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||||| |||||||||||| |
|
|
| T |
29555597 |
aaccaaaatgttcaaatatgcctttaatgagaactcttcacaaacaaatt |
29555548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 30034473 - 30034424
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
30034473 |
aggctaaaatatggttttgctccttgcaaatatgtctcgttttggtttta |
30034424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 30128283 - 30128332
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
30128283 |
aggctaaaatatggttttggtccctgcaaacatgtctcgttttggtttta |
30128332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35407791 - 35407742
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||| |||||| |
|
|
| T |
35407791 |
aggctaaaatatggttttgatccctgcaaatatgtcttgtttttgtttta |
35407742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 40545563 - 40545612
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
40545563 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttagtttta |
40545612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 45005889 - 45005934
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgatttta |
45005934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 45161116 - 45161161
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| | |||||||||||||| ||||||||||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggtttta |
45161161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 46901103 - 46901152
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
46901103 |
aggctaaaatatggttttagtctctgcaaatatgtatcgttttggtttta |
46901152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 49670803 - 49670754
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccc-tgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggtttta |
49670754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 51500397 - 51500446
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| || || ||| ||||||||||||||||||||||| |
|
|
| T |
51500397 |
aggctaaaatatggttctagtctctgtaaatatgcctcgttttggtttta |
51500446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 275833 - 275785
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
275833 |
ggctaaaatatgattttagtccctgtaaatatgcttcgttttggtttta |
275785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 7957226 - 7957178
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggtttta |
7957178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 10778366 - 10778418
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| ||||||||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
10778366 |
aaaaggttaaaatatggttttagtttctgcaaatatgcctcgttttgatttta |
10778418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 190 - 234
Target Start/End: Complemental strand, 21971046 - 21971002
Alignment:
| Q |
190 |
aaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
21971046 |
aaaatatggttttaatctctacaaatatgcctcgttttgatttta |
21971002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 190 - 234
Target Start/End: Complemental strand, 21993482 - 21993438
Alignment:
| Q |
190 |
aaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
21993482 |
aaaatatggttttaatctctacaaatatgcctcgttttgatttta |
21993438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 224
Target Start/End: Complemental strand, 26273826 - 26273786
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgt |
224 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
26273826 |
aaggctaaaatatggttttagtcccagcaaatatgcctcgt |
26273786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 218
Target Start/End: Complemental strand, 26800173 - 26800137
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatg |
218 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26800173 |
aaaaggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29678020 - 29678072
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
29678020 |
aaaaggctaaaatatagttttggtctttgcaaatatgcctcgttttggtttta |
29678072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 29686870 - 29686822
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| ||||| |||||||||||| ||| |||||||||||||| |
|
|
| T |
29686870 |
ggctaaaatatagttttgatccctgcaaatgtgcatcgttttggtttta |
29686822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 30424628 - 30424676
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || ||||| |||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagtttta |
30424676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 30426226 - 30426179
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgatttta |
30426179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 45313863 - 45313815
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgatttta |
45313815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 53701361 - 53701409
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| |||||| |
|
|
| T |
53701361 |
ggctaaaatatggttttaatctctgcaaatatgccttattttagtttta |
53701409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 9596759 - 9596806
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggtttta |
9596806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 225
Target Start/End: Original strand, 18175791 - 18175830
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgtt |
225 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcgtt |
18175830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 44506578 - 44506629
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
44506578 |
aaaaggctaaaatatggttttagtccctgcaaatataacgagttttggtttt |
44506629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 47901797 - 47901848
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||||| || ||| |||||||| |||||||||||||| |
|
|
| T |
47901797 |
aaaggttaaaatatggttttagtctctggaaatatgcatcgttttggtttta |
47901848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 2486581 - 2486627
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggtttta |
2486627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 234
Target Start/End: Complemental strand, 8510523 - 8510481
Alignment:
| Q |
192 |
aatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggtttta |
8510481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 12673983 - 12673933
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||| ||||| | |||||||||||||||| ||||||||||| |
|
|
| T |
12673983 |
aaggttaaaatatgattttagttcctgcaaatatgcctcattttggtttta |
12673933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 16679678 - 16679724
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggtttta |
16679724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 27200436 - 27200486
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||| |||| |||||| |
|
|
| T |
27200436 |
aaggttaaaatatggttttaatccctgcaaatatatctcattttagtttta |
27200486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta |
30034155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 35936778 - 35936828
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| | |||||||||||||| |
|
|
| T |
35936778 |
aaggctaaaatatggttttggtccctacaaatatacttcgttttggtttta |
35936828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 38232239 - 38232289
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
38232239 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttgatttta |
38232289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 4321945 - 4321994
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||| ||| ||||||||||| |
|
|
| T |
4321945 |
aggctaaaatatggttctgatccttgcaaatatgtctcattttggtttta |
4321994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 8555305 - 8555260
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggtttta |
8555260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 215
Target Start/End: Complemental strand, 10792974 - 10792941
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaat |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
10792974 |
aaaaggctaaaatatggttttagtccctgcaaat |
10792941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 13514578 - 13514529
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||| | |||||||||||| ||||||||||||||| |
|
|
| T |
13514578 |
aggctaaaatatgattttggtacctgcaaatatgtctcgttttggtttta |
13514529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 227
Target Start/End: Original strand, 19844265 - 19844306
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgtttt |
227 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgtttt |
19844306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 20404889 - 20404938
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||||| |||||||| |
|
|
| T |
20404889 |
aggctaaaatatggttttgcttcctgcaaatatacctcgttatggtttta |
20404938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 28452146 - 28452195
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| || |||||||||||| |
|
|
| T |
28452146 |
aggctaaaatatggttttggtccttgcaaatatgtcttgttttggtttta |
28452195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 32119219 - 32119268
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
32119219 |
aggctaaaatatagttttggtccctgcaaatatgtctcgttttagtttta |
32119268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 35177563 - 35177518
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| || ||||||||||| |
|
|
| T |
35177563 |
taaaatatggttttcatccttgcaaatatgcttccttttggtttta |
35177518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 35498415 - 35498464
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||| |||||||||||||| |
|
|
| T |
35498415 |
aggctaaaatatgggtttagtccctacaaatatgattcgttttggtttta |
35498464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 40723121 - 40723166
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||| ||||||||| ||||| |||||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggtttta |
40723166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 46622130 - 46622081
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
46622130 |
aggctaaaatatggttttggtccttgcaaatatgtttcgttttggtttta |
46622081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 49324143 - 49324098
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
49324098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 228
Target Start/End: Complemental strand, 53113757 - 53113716
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttg |
228 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||||||||| |
|
|
| T |
53113757 |
gctaaaatatggttttgatccatgcaaatatacctcgttttg |
53113716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 29678387 - 29678339
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||| |
|
|
| T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatgccctgttttggtttta |
29678339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 217
Target Start/End: Original strand, 39819303 - 39819343
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatat |
217 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||||||||||| |
|
|
| T |
39819303 |
tattttaaagcctaaaatatggttttagtccctgcaaatat |
39819343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 40370285 - 40370333
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||| |||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagtttta |
40370333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 217
Target Start/End: Complemental strand, 45268630 - 45268598
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatat |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
45268630 |
aggctaaaatatgtttttaatccctgcaaatat |
45268598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 47902145 - 47902097
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| |||||| |||| |||||||||| | |||||||||||| |
|
|
| T |
47902145 |
ggctaaaatatagttttagtccccgcaaatatgcattgttttggtttta |
47902097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 50009284 - 50009236
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||| ||||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgatttta |
50009236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 50261936 - 50261888
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| || ||||||||||| |
|
|
| T |
50261936 |
ggctaaaatatcgttttagtccctgcaaatatgtttcattttggtttta |
50261888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 171)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 6108329 - 6108382
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6108329 |
taaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
6108382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 44509059 - 44509006
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44509059 |
taaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44509006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 8555802 - 8555751
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8555802 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8555751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 12894405 - 12894354
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12894405 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
12894354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 19757745 - 19757796
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19757745 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19757796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 176 - 234
Target Start/End: Complemental strand, 28911917 - 28911858
Alignment:
| Q |
176 |
ttatttaa-aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28911917 |
ttatttaacaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28911858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 37372907 - 37372856
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37372907 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37372856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 9659698 - 9659641
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9659698 |
tattttaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
9659641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 17999722 - 17999673
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17999722 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
17999673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 25547256 - 25547301
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
25547301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 35665876 - 35665925
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35665876 |
aggctaaaatatggttttaatccctacaaatatgcctcgttttggtttta |
35665925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 1006835 - 1006883
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1006883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6509204 - 6509256
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
6509204 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttcgtttta |
6509256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 7431951 - 7431999
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7431999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 19561154 - 19561202
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19561202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44344793 - 44344741
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
44344793 |
aaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
44344741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 44508720 - 44508768
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44508768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 174 - 234
Target Start/End: Complemental strand, 44568701 - 44568642
Alignment:
| Q |
174 |
cattatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
44568701 |
cattatttaaa-ggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
44568642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 1614907 - 1614856
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1614907 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1614856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 3975546 - 3975597
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3975546 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3975597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 17999465 - 17999512
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
17999512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 25988752 - 25988701
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25988752 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25988701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 181 - 232
Target Start/End: Original strand, 30352555 - 30352606
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30352555 |
taaaaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
30352606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 34878128 - 34878077
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
34878128 |
aaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 234
Target Start/End: Complemental strand, 45228929 - 45228870
Alignment:
| Q |
175 |
attatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| || ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45228929 |
attatatataaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
45228870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 46648718 - 46648667
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
46648718 |
aaaggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 6509472 - 6509422
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
6509472 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
6509422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 13770083 - 13770033
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
13770083 |
aaggctaaaatatggttttagtccctgcaaatatgccccgttttggtttta |
13770033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 21223750 - 21223700
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
21223750 |
aaggctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
21223700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 45073643 - 45073593
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45073643 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
45073593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 3975839 - 3975790
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3975839 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3975790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 8144659 - 8144610
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8144659 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
8144610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 10358377 - 10358320
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| || |||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
10358377 |
tattttaatggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
10358320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 14739013 - 14738956
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
14739013 |
tattaaaaaggctaaaatatggttttagtccctgcaaatatgcttcgttttgatttta |
14738956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 18022705 - 18022656
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18022705 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
18022656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 20388273 - 20388322
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
20388273 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
20388322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 23399611 - 23399660
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23399611 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23399660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 23676453 - 23676404
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23676453 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23676404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 23816669 - 23816718
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
23816669 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
23816718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 26878072 - 26878023
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26878072 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
26878023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 28911576 - 28911625
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
28911576 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
28911625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 29198663 - 29198614
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29198663 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29198614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35015221 - 35015172
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
35015221 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
35015172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 39832905 - 39832954
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
39832905 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
39832954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 45021857 - 45021808
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
45021857 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
45021808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 45073313 - 45073362
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
45073313 |
aggctaaaatatggttttagtccctgcaaataagcctcgttttggtttta |
45073362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 48192489 - 48192440
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48192489 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
48192440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 183 - 227
Target Start/End: Complemental strand, 1559708 - 1559664
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgtttt |
227 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1559708 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
1559664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6079805 - 6079857
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
6079805 |
aaaaagctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
6079857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 13769774 - 13769822
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13769822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 16853589 - 16853541
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16853541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 19561450 - 19561402
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19561402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 23399980 - 23399928
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
23399980 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
23399928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 25092552 - 25092500
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
25092552 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctctttttggtttta |
25092500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 27458395 - 27458447
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
27458395 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
27458447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 184 - 232
Target Start/End: Complemental strand, 31310681 - 31310633
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
31310681 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 31732101 - 31732149
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
31732149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 35210515 - 35210467
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
35210467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 39833236 - 39833188
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
39833188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 48359075 - 48359027
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
48359027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 5233805 - 5233856
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5233805 |
aaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
5233856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 6589021 - 6589068
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
6589068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 8144292 - 8144343
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
8144292 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8144343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 25092157 - 25092208
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
25092157 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25092208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 31732454 - 31732403
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
31732454 |
aaaggctaaaatatggttttagtccatgcaaatatgcctcgttttgatttta |
31732403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 186 - 229
Target Start/End: Original strand, 45021494 - 45021537
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttgg |
229 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgg |
45021537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 48192254 - 48192305
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48192254 |
aaaggttaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
48192305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 48852441 - 48852492
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
48852441 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgtttta |
48852492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 1559341 - 1559391
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
1559341 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
1559391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 26877676 - 26877726
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
26877676 |
aaggctaaaatatggttttgatctctgcaaatatgtctcgttttggtttta |
26877726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 30223797 - 30223747
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
30223797 |
aaggctaaaatatggttttggtccatgcaaatatgcctcgttttggtttta |
30223747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 32189388 - 32189342
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
32189342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 35837922 - 35837972
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35837922 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35837972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 44402958 - 44403008
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| | ||||||||||| |
|
|
| T |
44402958 |
aaggctaaaatatggttttagtccctgcaaatatgccccattttggtttta |
44403008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 46304084 - 46304134
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| | |||||||||||||||||||||||||||| |
|
|
| T |
46304084 |
aaggctaaaatatgattttagttcctgcaaatatgcctcgttttggtttta |
46304134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 1614558 - 1614607
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
1614558 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
1614607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 2945854 - 2945797
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||| |||||||||||||||||||||||| |
|
|
| T |
2945854 |
tattaaaaaggctaaaatatgtttttggtccctacaaatatgcctcgttttggtttta |
2945797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 5354767 - 5354816
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
5354767 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
5354816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 7432249 - 7432204
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgatttta |
7432204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 10358000 - 10358049
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
10358000 |
aggctaaaatatgatcttagtccctgcaaatatgcctcgttttggtttta |
10358049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 16940757 - 16940810
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
16940757 |
taaaaggctaacatatggttttggtccctgcaaatatgcctcggtttggtttta |
16940810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 19783814 - 19783863
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
19783814 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
19783863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 21554754 - 21554705
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
21554754 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttgatttta |
21554705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 22539929 - 22539978
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
22539929 |
aggctaaaatatggttttgatccctccaaatatgcctcattttggtttta |
22539978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 25988384 - 25988433
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
25988384 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25988433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 28262712 - 28262761
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
28262712 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
28262761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 30709645 - 30709596
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
30709645 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
30709596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35104296 - 35104247
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35104296 |
aggctcaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35104247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35470281 - 35470232
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
35470281 |
aggctaaaatttggttttgatccctgcaaatatgcctcattttggtttta |
35470232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35838338 - 35838289
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35838338 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35838289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 38486791 - 38486742
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
38486791 |
aggctaaaatatggttttgatccctgtaaatatgccccgttttggtttta |
38486742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 39438740 - 39438789
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
39438740 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
39438789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 39719643 - 39719594
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
39719643 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttagtttta |
39719594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 41054237 - 41054188
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
41054237 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
41054188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 44841359 - 44841404
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
44841404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 46759657 - 46759706
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
46759657 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
46759706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 1007229 - 1007181
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgatttta |
1007181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 1974009 - 1974057
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
1974057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 6589278 - 6589226
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
6589278 |
aaaaggttaaaatatggttttggtccctgcaaatatgccttgttttggtttta |
6589226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 189 - 233
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
11766964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14543706 - 14543758
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
14543706 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
14543758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18311576 - 18311628
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
18311576 |
aaaaagctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 21223405 - 21223453
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
21223453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 21554393 - 21554441
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggtttta |
21554441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 25547490 - 25547442
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
25547442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 27037593 - 27037641
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
27037641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 30352904 - 30352856
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
30352856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 35469880 - 35469928
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggtttta |
35469928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 190 - 234
Target Start/End: Original strand, 37372441 - 37372485
Alignment:
| Q |
190 |
aaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
37372485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 39719353 - 39719401
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggtttta |
39719401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 41364884 - 41364932
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||||| ||||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggtttta |
41364932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 41365218 - 41365166
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
41365218 |
aaaacgctaaaatatggttttagttcccgcaaatatgcctcgttttggtttta |
41365166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 44403249 - 44403201
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
44403201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 46829312 - 46829264
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggtttta |
46829264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 48854074 - 48854022
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
48854074 |
aaaaggctaaaatatgattttgatccctgcaaatatgtttcgttttggtttta |
48854022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 5234207 - 5234156
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
5234207 |
aaaggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5234156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 18022368 - 18022415
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggtttta |
18022415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 30223458 - 30223509
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
30223458 |
aaaggctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
30223509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 39439032 - 39438981
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
39439032 |
aaaggctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
39438981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 43300613 - 43300660
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggtttta |
43300660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 5308688 - 5308639
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
5308688 |
aaggctaaaatatg-ttttagtccctgcaaatatacctcgttttggtttta |
5308639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 6847117 - 6847071
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
6847071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 17854151 - 17854197
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
17854197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 30709323 - 30709373
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||| ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
30709323 |
aaggttaaaatatgattttagtccctacaaatatgcctcgttttggtttta |
30709373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 38186364 - 38186414
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
38186364 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
38186414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 41053840 - 41053890
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
41053840 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttgatttta |
41053890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 44568324 - 44568374
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
44568324 |
aaggctaaaatatggttttggtccctgcaaatataactcgttttggtttta |
44568374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 46828942 - 46828992
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
46828942 |
aaggctaaaatatggttttggtccctgcaaatatgtcttgttttggtttta |
46828992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 5355114 - 5355069
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggtttta |
5355069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 9659354 - 9659403
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
9659354 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgatttta |
9659403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 11767276 - 11767227
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
11767276 |
aggctaaaatatggttttggtccctgcaaatatgcttcattttggtttta |
11767227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 12932784 - 12932735
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||| ||||| |
|
|
| T |
12932784 |
aggctaaaatatgtttttggtccctgcaaatatgcctcgttttgatttta |
12932735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 16941049 - 16941004
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16941004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 23676135 - 23676180
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
23676180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 29198302 - 29198351
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
29198302 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggtttta |
29198351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 31310364 - 31310413
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
31310364 |
aggctaaaatatgattttagtccctgcaaatatttctcgttttggtttta |
31310413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 31503780 - 31503735
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
31503735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 35210181 - 35210230
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||| ||||||||||||||| |
|
|
| T |
35210181 |
aggctaaaatatgattttgatcccggcaaatatgactcgttttggtttta |
35210230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 44958515 - 44958458
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||||| |||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
44958515 |
tatttcaaaggctaaaatatgattttggtccctacaaatatgtctcgttttggtttta |
44958458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 5308323 - 5308371
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||| |||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagtttta |
5308371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 20388675 - 20388627
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| || ||| ||||||||||||||||| ||||| |
|
|
| T |
20388675 |
ggctaaaatatggttttagtcgctgaaaatatgcctcgttttgatttta |
20388627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 46304384 - 46304336
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| |||||||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggtttta |
46304336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 46759942 - 46759894
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
46759894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 195 - 234
Target Start/End: Complemental strand, 1271590 - 1271551
Alignment:
| Q |
195 |
atggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggtttta |
1271551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 230
Target Start/End: Complemental strand, 23817037 - 23816990
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
230 |
Q |
| |
|
||||||||||||||||||||| || ||| ||||||| ||||||||||| |
|
|
| T |
23817037 |
aaaggctaaaatatggttttagtctctgtaaatatgtctcgttttggt |
23816990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 35104075 - 35104126
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35104075 |
aaaggctaaaatataattttggtccctgcaaatatgtctcgttttggtttta |
35104126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 36684532 - 36684583
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
36684532 |
aaaggctaaaatatggctttgatccatgcaaatatatctcgttttggtttta |
36684583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 39520395 - 39520446
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||| ||||||||||||||| |
|
|
| T |
39520395 |
aaaggctaaaatatggttttggtccatccaaatatgtctcgttttggtttta |
39520446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 44344454 - 44344505
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| | || ||||||||| ||||||| ||||||| |
|
|
| T |
44344454 |
aaaggctaaaatatggttttagttcccgcaaatatgtctcgtttcggtttta |
44344505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 489074 - 489024
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| || ||||||||||| ||||||||| ||||| |
|
|
| T |
489074 |
aaggctaaaatatgattttagtctctgcaaatatgtctcgttttgatttta |
489024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 18311938 - 18311892
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18311938 |
ctaaaatatgattttaatccctctaaatatgcctcgttttgatttta |
18311892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 227
Target Start/End: Complemental strand, 18891562 - 18891524
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgtttt |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgtttt |
18891524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 20355407 - 20355453
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtt |
231 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||| |||||||||||| |
|
|
| T |
20355407 |
aggctaaaatatgattttgatccttgcaaatatgactcgttttggtt |
20355453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 37953053 - 37953003
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||| || |||||||||||| |
|
|
| T |
37953053 |
aaggataaaatatggttttagtccctgtaaatatgtcttgttttggtttta |
37953003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 234
Target Start/End: Original strand, 45671204 - 45671262
Alignment:
| Q |
176 |
ttatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| | ||| ||||||||||||||| ||| |||||||||| |||||||| |||||| |
|
|
| T |
45671204 |
ttattttataggttaaaatatggttttagtccatgcaaatatgtctcgttttagtttta |
45671262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 3807863 - 3807912
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
3807863 |
aggctaaaatatagttttggttcctgcaaatatgtctcgttttggtttta |
3807912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 205 - 234
Target Start/End: Original strand, 12894060 - 12894089
Alignment:
| Q |
205 |
tccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12894060 |
tccctgcaaatatgcctcgttttggtttta |
12894089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 14738603 - 14738648
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggtttta |
14738648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 19465981 - 19465933
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||| ||||||| |
|
|
| T |
19465981 |
aggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggtttta |
19465933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 34877777 - 34877822
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
34877822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 45228614 - 45228663
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||| |||||| |
|
|
| T |
45228614 |
aggctaaaatatggttttgggccccgcaaatatgcctcgtttttgtttta |
45228663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 192 - 232
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
192 |
aatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 234
Target Start/End: Original strand, 6954862 - 6954906
Alignment:
| Q |
190 |
aaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggtttta |
6954906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 217
Target Start/End: Original strand, 17066424 - 17066456
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatat |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
17066424 |
aggctaaaatatgcttttaatccctgcaaatat |
17066456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 18927091 - 18927043
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| ||| |||| |||||| |
|
|
| T |
18927091 |
ggctaaaatatagttttagtccctgcaaatatgtctcattttagtttta |
18927043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 24717532 - 24717484
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||| | |||||| ||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggtttta |
24717484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 234
Target Start/End: Original strand, 24953828 - 24953868
Alignment:
| Q |
194 |
tatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggtttta |
24953868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 218
Target Start/End: Complemental strand, 28263075 - 28263039
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatg |
218 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
28263075 |
aaaagactaaaatatggttttgatccctgcaaatatg |
28263039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 233
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 9e-20; HSPs: 131)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 12419707 - 12419756
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12419707 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
12419756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 12419939 - 12419890
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12419939 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
12419890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 32885672 - 32885721
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32885672 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
32885721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33801747 - 33801695
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33801747 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33801695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 15076207 - 15076156
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15076207 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
15076156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 7155791 - 7155845
Alignment:
| Q |
180 |
ttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7155791 |
ttaaaaggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
7155845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 234
Target Start/End: Complemental strand, 8681126 - 8681068
Alignment:
| Q |
176 |
ttatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
8681126 |
ttattaaaaaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
8681068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 24274133 - 24274083
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24274133 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24274083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 26375691 - 26375741
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26375691 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
26375741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 778043 - 777994
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
778043 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttagtttta |
777994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 7156161 - 7156112
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7156161 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7156112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 494405 - 494453
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
494453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 15962389 - 15962341
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
15962341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 19296407 - 19296359
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19296359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 22792903 - 22792851
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
22792903 |
aaaaggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
22792851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 30928677 - 30928729
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
30928677 |
aaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
30928729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31166866 - 31166918
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31166866 |
aaaaagctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
31166918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 34582529 - 34582577
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
34582577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 3356139 - 3356190
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3356139 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
3356190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 8680768 - 8680823
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8680768 |
tttaataggctaaaatatgtttttagtccctgcaaatatgcctcgttttggtttta |
8680823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 17771904 - 17771959
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
17771904 |
tttaaatggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
17771959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 21385244 - 21385299
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
21385244 |
tttaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
21385299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 21995061 - 21995112
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
21995061 |
aaaggctaaaatatggttttagtccctgcatatatgcctcgttttggtttta |
21995112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 22822654 - 22822603
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
22822654 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
22822603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 23502233 - 23502284
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23502233 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 24273825 - 24273876
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24273825 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
24273876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 30929051 - 30928996
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| |||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30929051 |
tttaaatggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
30928996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 3969015 - 3968961
Alignment:
| Q |
180 |
ttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3969015 |
ttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3968961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 12299142 - 12299092
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12299142 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
12299092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 23502542 - 23502492
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
23502542 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23502492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 318098 - 318049
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
318098 |
aggctaaaatatggttttaatccctgcaaatatgtttcgttttggtttta |
318049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 1007510 - 1007461
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1007510 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1007461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 1890453 - 1890404
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
1890453 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
1890404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 2615871 - 2615920
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
2615871 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
2615920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 184 - 233
Target Start/End: Complemental strand, 2616242 - 2616193
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
2616242 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 3356495 - 3356450
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3356450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 3414386 - 3414435
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3414386 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3414435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 6591113 - 6591162
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
6591113 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 14655378 - 14655427
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14655378 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
14655427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 15962026 - 15962075
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
15962026 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
15962075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 19321132 - 19321083
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19321132 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19321083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 20467719 - 20467670
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20467719 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20467670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 21994404 - 21994355
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21994404 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
21994355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 22543353 - 22543402
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22543353 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
22543402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 25137358 - 25137309
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25137358 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25137309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 25431855 - 25431806
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
25431855 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
25431806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 26376042 - 26375997
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
26375997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 34582893 - 34582844
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
34582893 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
34582844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 494756 - 494704
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
494756 |
aaaaagctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 190 - 234
Target Start/End: Original strand, 543365 - 543409
Alignment:
| Q |
190 |
aaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 2373176 - 2373224
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtt |
231 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
2373176 |
aaaggctaaaatatggttttagtccctgcaaatatgccttgttttggtt |
2373224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6468306 - 6468358
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
6468306 |
aaaaggctaaaatatggttttagtccctgcaaatatgctttgttttggtttta |
6468358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13150754 - 13150702
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| ||||||||||||||| |
|
|
| T |
13150754 |
aaaaggctaaaatatggtattaacccctgcaaatatgtctcgttttggtttta |
13150702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19690389 - 19690441
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
19690389 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19690441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 21385588 - 21385536
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
21385588 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
21385536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33131854 - 33131802
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
33131854 |
aaaaggctaaaatatggttttagtctttgcaaatatgcctcgttttggtttta |
33131802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 3414767 - 3414704
Alignment:
| Q |
171 |
tcacattatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
3414767 |
tcacattagataaaaggctaaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
3414704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 11129543 - 11129496
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11129543 |
ggctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 11449171 - 11449124
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtt |
231 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
11449171 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtt |
11449124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 14428651 - 14428698
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
14428698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 17765006 - 17765057
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
17765006 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17765057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 22822304 - 22822355
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| |||||||||||||||| |
|
|
| T |
22822304 |
aaaggctaaaatatggttttagtctctgcaaatatacctcgttttggtttta |
22822355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 23770162 - 23770209
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23770209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 25136991 - 25137042
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
25136991 |
aaaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggtttta |
25137042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 33808613 - 33808668
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
33808613 |
tttaagaggctaaaatatggttttagtccctgtaaatatgcctcgttttgatttta |
33808668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 234
Target Start/End: Complemental strand, 34990326 - 34990267
Alignment:
| Q |
175 |
attatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||| |||| ||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
34990326 |
attatttttaaggttaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
34990267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 3276356 - 3276306
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3276356 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3276306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 3968643 - 3968693
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3968643 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3968693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 5286949 - 5286903
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
5286903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 6412581 - 6412531
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
6412581 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
6412531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 9896639 - 9896589
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
9896639 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
9896589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 11448535 - 11448585
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
11448535 |
aaggctaaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
11448585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 12757608 - 12757658
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
12757608 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12757658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 13268107 - 13268157
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
13268107 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgtttaggtttta |
13268157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 185 - 227
Target Start/End: Complemental strand, 23770440 - 23770398
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgtttt |
227 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23770440 |
aggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 317811 - 317860
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
317811 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
317860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 1007123 - 1007172
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
1007123 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
1007172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 1214997 - 1214948
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
1214997 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggtttta |
1214948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 6412217 - 6412266
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6412217 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
6412266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 7324189 - 7324144
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
7324144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 8170152 - 8170103
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
8170152 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8170103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 10910965 - 10910916
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10910965 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10910916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 12176640 - 12176595
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
12176595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 12612360 - 12612311
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
12612360 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgttttagtttta |
12612311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 21147403 - 21147452
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
21147403 |
aggctaaaatatggttttggtccctgcaaatatgcatcgttttggtttta |
21147452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 21993786 - 21993835
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
21993786 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggtttta |
21993835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 22543719 - 22543670
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
22543719 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
22543670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 24692980 - 24692931
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
24692980 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgctttta |
24692931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 185 - 229
Target Start/End: Original strand, 1875501 - 1875545
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttgg |
229 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
1875501 |
aggctaaaatatagctttaatccctgcaaatatgcctcgttttgg |
1875545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 19296100 - 19296156
Alignment:
| Q |
178 |
atttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||| ||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
19296100 |
attttaaaggctaaaacatggttttagtccctgcaaatatgcgtcgttttgatttta |
19296156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 21995425 - 21995377
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggcttta |
21995377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 24901239 - 24901287
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
24901287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 31167200 - 31167152
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgatttta |
31167152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 31198615 - 31198663
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
31198663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 777674 - 777725
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
777674 |
aaaggctaaaatatgattttagttcctgcaaatatacctcgttttggtttta |
777725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 1890056 - 1890107
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
1890056 |
aaaggttaaaatatggttttagtccctgtaaatatgcctcgttttgatttta |
1890107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 20467348 - 20467399
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20467348 |
aaaggataaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
20467399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 34989962 - 34990009
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgatttta |
34990009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 6591440 - 6591394
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggtttta |
6591394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 9896280 - 9896326
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| |||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagtttta |
9896326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 13617531 - 13617577
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
13617577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 14428948 - 14428902
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggtttta |
14428902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 14656262 - 14656212
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
14656262 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
14656212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 222
Target Start/End: Complemental strand, 15117042 - 15117004
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctc |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15117042 |
aaggctaaaatatggttttagtccctgcaaatatgcctc |
15117004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 31398543 - 31398493
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
31398543 |
aaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
31398493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 543725 - 543676
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
543725 |
aggctaaaatatgattttagtccctgcaaatatgctttgttttggtttta |
543676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 10091039 - 10091084
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
10091084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 18024376 - 18024327
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
18024376 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggtttta |
18024327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 19129335 - 19129384
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| ||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
19129335 |
aggctacaatatggctttggtccctgcaaatatgcctcgttttggtttta |
19129384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 25121183 - 25121231
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
25121183 |
aggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggtttta |
25121231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 15442937 - 15442985
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgatttta |
15442985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 19267565 - 19267613
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggtttta |
19267613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 25431568 - 25431624
Alignment:
| Q |
178 |
atttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||| |||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
25431568 |
atttataaggctaaaatatgattttaatccctgtaaatatgtttcgttttgatttta |
25431624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 30239293 - 30239341
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggtttta |
30239341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 30479426 - 30479374
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
30479426 |
aaaaagctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
30479374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 31186591 - 31186543
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgtttta |
31186543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 7323861 - 7323916
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaat----ccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
7323861 |
aaaggctaaaatatggttttaattagcccttgcaaatatgtctcgttttggtttta |
7323916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 15116672 - 15116719
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
15116672 |
aggctaaaatatggttttagtcgctgcaaatat--ctcgttttggtttta |
15116719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 19320769 - 19320815
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
19320815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 6564944 - 6564896
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6564944 |
aggctaaaat-tggttttggtccctgcaaatatgtctcgttttggtttta |
6564896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 12298825 - 12298870
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgtttta |
12298870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 13617797 - 13617768
Alignment:
| Q |
205 |
tccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13617797 |
tccctgcaaatatgcctcgttttggtttta |
13617768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 15722901 - 15722852
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||| || ||||||||| |
|
|
| T |
15722901 |
aggctaaaatatagttttgattcctgcaaatatgccttgtgttggtttta |
15722852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 18024014 - 18024059
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggtttta |
18024059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 19129521 - 19129472
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| | ||||||||||||| |
|
|
| T |
19129521 |
aggctaaaatatgattttggtccctgcaaatatgtcacgttttggtttta |
19129472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 25121497 - 25121448
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
25121497 |
aggctaaaatatggttttggtgcctgcaaatatgtttcgttttggtttta |
25121448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 10910629 - 10910677
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggtttta |
10910677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 12611995 - 12612043
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||| ||||| |||||| |
|
|
| T |
12611995 |
ggctaaaatatggtgttagtccctgcaaatatgccctgttttagtttta |
12612043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 227
Target Start/End: Complemental strand, 17765378 - 17765334
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgtttt |
227 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
17765378 |
aaaggctaaaatatgattttggtccctgcaaatatgtctcgtttt |
17765334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 23628794 - 23628846
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
23628794 |
aaaaagctaaaatatggttttggtccctgcaaatatatttcgttttggtttta |
23628846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtt |
231 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||| |||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 9e-20; HSPs: 158)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 21124908 - 21124961
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21124908 |
taaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
21124961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 28863505 - 28863558
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28863505 |
taaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28863558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 293820 - 293876
Alignment:
| Q |
178 |
atttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
293820 |
atttaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
293876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 10743720 - 10743772
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10743720 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10743772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 16038373 - 16038425
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16038373 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16038425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 2217491 - 2217542
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2217491 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2217542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 7075569 - 7075620
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7075569 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7075620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 18633596 - 18633647
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18633596 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18633647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 36578086 - 36578035
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36578086 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
36578035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 4203454 - 4203504
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4203454 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4203504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 29172888 - 29172838
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29172888 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29172838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 29875398 - 29875448
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29875398 |
aaggctaaaatatgattttaatccctgcaaatatgcctcgttttggtttta |
29875448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 35167167 - 35167117
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35167167 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35167117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 2217855 - 2217806
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2217806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 5614531 - 5614482
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5614531 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5614482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 5950175 - 5950224
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5950175 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5950224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 9179925 - 9179872
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
9179925 |
taaaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9179872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 18046349 - 18046300
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18046349 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18046300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 25562000 - 25561951
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25562000 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 29692743 - 29692792
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29692743 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29692792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 29875726 - 29875677
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29875726 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29875677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 30800493 - 30800542
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30800493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30800542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 30800851 - 30800802
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30800851 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30800802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 6118499 - 6118451
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
6118451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 10408924 - 10408976
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
10408924 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10408976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 18633961 - 18633913
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18633913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 28550827 - 28550875
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28550875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 28863838 - 28863790
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28863790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35928060 - 35928112
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35928060 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35928112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 40029497 - 40029449
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
40029449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 40167782 - 40167834
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40167782 |
aaaaggctaaagtatggttttagtccctgcaaatatgcctcgttttggtttta |
40167834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 26133416 - 26133365
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
26133416 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26133365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 27916767 - 27916716
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27916767 |
aaaggttaaaatatggttttattccctgcaaatatgcctcgttttggtttta |
27916716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 29172524 - 29172571
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29172571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 38170511 - 38170562
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38170511 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38170562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 40764783 - 40764732
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40764783 |
aaaggctaaaatatggttttgctccctgcaaatatgcctcgttttggtttta |
40764732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 1381613 - 1381563
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1381613 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1381563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 5917462 - 5917412
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5917462 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5917412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 234
Target Start/End: Original strand, 11799119 - 11799177
Alignment:
| Q |
176 |
ttatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
11799119 |
ttatttagaaggctaaaatatggttttagtccctgcaaatatgcattgttttggtttta |
11799177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 13990897 - 13990847
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13990897 |
aaggctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
13990847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 15635709 - 15635659
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
15635709 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttta |
15635659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 18046032 - 18046086
Alignment:
| Q |
180 |
ttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
18046032 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
18046086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 19685382 - 19685332
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19685382 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19685332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 20660946 - 20660996
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20660946 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20660996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 29151853 - 29151803
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
29151853 |
aaggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
29151803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 35166909 - 35166959
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
35166909 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
35166959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 38786157 - 38786207
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
38786157 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
38786207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 40764413 - 40764463
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40764413 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
40764463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 1105149 - 1105100
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1105149 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1105100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 1381242 - 1381295
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
1381242 |
taaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
1381295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 10409327 - 10409278
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
10409327 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10409278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 11799459 - 11799410
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggtttta |
11799410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 19565832 - 19565783
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19565832 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19565783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 24443745 - 24443696
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24443745 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24443696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 31037742 - 31037693
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31037742 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 34125306 - 34125355
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34125306 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
34125355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 36577721 - 36577770
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
36577721 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
36577770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 39379611 - 39379562
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
39379611 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
39379562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 40038493 - 40038542
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
40038493 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2636997 - 2636945
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2636997 |
aaaaagctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2636945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 5614162 - 5614214
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
5614162 |
aaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
5614214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 6912497 - 6912545
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
6912545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 23382297 - 23382249
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
23382249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 25561705 - 25561753
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
25561753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 26133183 - 26133231
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
26133231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 29366949 - 29366901
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29366901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 33336026 - 33335978
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
33335978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 3850299 - 3850346
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt |
3850346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 9532538 - 9532487
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
9532538 |
aaaggttaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9532487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 18258530 - 18258479
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
18258530 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
18258479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 16038738 - 16038692
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
16038692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 18286743 - 18286693
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
18286743 |
aaggctaaaaaatggttttagtccctgcaaatatacctcgttttggtttta |
18286693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 19565465 - 19565515
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
19565465 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19565515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 20986091 - 20986041
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
20986091 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
20986041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 24443378 - 24443428
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
24443378 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
24443428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 28213371 - 28213421
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
28213371 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
28213421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 28871996 - 28871946
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28871996 |
aaggctaaattatggttttggtccctgcaaatatgcctcgttttggtttta |
28871946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 29693092 - 29693042
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
29693092 |
aaggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
29693042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 34125634 - 34125584
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
34125634 |
aaggctaaaatatggttttagtccctgtaaatatgcctcattttggtttta |
34125584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 35876686 - 35876736
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
35876686 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
35876736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 38496784 - 38496734
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
38496784 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
38496734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 40029139 - 40029189
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
40029139 |
aaggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
40029189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 1104857 - 1104906
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
1104857 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
1104906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 3850600 - 3850551
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3850600 |
aggctgaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
3850551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 4203771 - 4203722
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
4203771 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
4203722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 5917125 - 5917174
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
5917125 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
5917174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 10744055 - 10744006
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
10744055 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
10744006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 14318044 - 14318093
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
14318044 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
14318093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 19685016 - 19685065
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
19685016 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19685065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 20690732 - 20690781
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
20690732 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
20690781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 20985728 - 20985773
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20985773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 23381949 - 23381998
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
23381949 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggtttta |
23381998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 24781988 - 24782037
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
24781988 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggtttta |
24782037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 25779163 - 25779114
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
25779163 |
aggctaaaatatggttttagtccctgcaaatatgcttcattttggtttta |
25779114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35877053 - 35877004
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35877053 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35877004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 37271358 - 37271407
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
37271358 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggtttta |
37271407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 39379242 - 39379287
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
39379287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 40168021 - 40167960
Alignment:
| Q |
173 |
acattatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||| |||||||||||| |||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
40168021 |
acattttttaataggctaaaatattgttttagtccatgcaaatatgtctcgttttggtttta |
40167960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 45138 - 45186
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 2032940 - 2032892
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggtttta |
2032892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 6912861 - 6912809
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6912861 |
aaaagactaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
6912809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 21050913 - 21050865
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgatttta |
21050865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 29151516 - 29151564
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgatttta |
29151564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 30888160 - 30888208
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
30888208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 35928458 - 35928410
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35928410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 38962806 - 38962854
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
38962854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 42994068 - 42994116
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 26071619 - 26071568
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
26071619 |
aaaggttaaaatatgattttgatccctgcaaatatgtctcgttttggtttta |
26071568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 37271709 - 37271658
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
37271709 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
37271658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 4736544 - 4736494
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
4736544 |
aaggctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
4736494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 16616370 - 16616416
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagtttta |
16616416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 18258160 - 18258210
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
18258160 |
aaggctaaaatatggttttggtccctgcaaatatggctcattttggtttta |
18258210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 20683745 - 20683795
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| |||||||| ||||| |
|
|
| T |
20683745 |
aaggctaaaatatggttttagtctctgcaaatatgcatcgttttgatttta |
20683795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 31602142 - 31602188
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtt |
231 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||| ||||||||||| |
|
|
| T |
31602142 |
aggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt |
31602188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 35609635 - 35609589
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35609589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 38554750 - 38554797
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
38554750 |
aggctaaaatatggttttgatccctgcaaatat--ctcgttttggtttta |
38554797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 5904007 - 5904056
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
5904007 |
aggctaaaatatggttttgctccttgcaaatatgcctcgttttgatttta |
5904056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 9179592 - 9179641
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggtttta |
9179641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 12144906 - 12144955
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
12144906 |
aggctaaaatatggtttttgtccctgtaaatatgcctctttttggtttta |
12144955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 17070864 - 17070815
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||| |||||| |
|
|
| T |
17070864 |
aggctaaaatatggttttagtccctacaaatatgtctcgttttcgtttta |
17070815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 28108159 - 28108114
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggtttta |
28108114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35166159 - 35166110
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| |||||||||||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
35166159 |
aggctataatatggttttagtccctgcaaaaatgtctcgttttggtttta |
35166110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 42207241 - 42207290
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||| ||||||||||||||| |
|
|
| T |
42207241 |
aggctaaaatatggttttagtccttgtaaatatgtctcgttttggtttta |
42207290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 1286682 - 1286730
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggtttta |
1286730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 2636669 - 2636717
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
2636717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 226
Target Start/End: Original strand, 17070531 - 17070575
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttt |
226 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
17070531 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttt |
17070575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 232
Target Start/End: Original strand, 20416358 - 20416406
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
20416358 |
aaggctaaaatatggttttcgtccctgcaaatatgtctcgctttggttt |
20416406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 20661311 - 20661263
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggtttta |
20661263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 35609303 - 35609351
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggtttta |
35609351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 40038858 - 40038810
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggtttta |
40038810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 42553642 - 42553690
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
42553690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 27850377 - 27850326
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||| ||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
27850377 |
aaagactaaaatatgattttagtctctgcaaatatgtctcgttttggtttta |
27850326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 38452399 - 38452348
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
38452399 |
aaagcctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 15635374 - 15635424
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||| || |||||||||||| |
|
|
| T |
15635374 |
aaggataaaatatggttttagtccatgcaaatatgtcttgttttggtttta |
15635424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 31037397 - 31037443
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||| |||||| ||||| |
|
|
| T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgatttta |
31037443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 42207570 - 42207525
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||| | |||||||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggtttta |
42207525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 42596451 - 42596501
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || |||||||||||| |
|
|
| T |
42596451 |
aaggctaaaatatggttttgatcccagcaaatatatcttgttttggtttta |
42596501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 3851330 - 3851281
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||||||||| ||||| |
|
|
| T |
3851330 |
aggctaaaatatggttttagtccctcaaaatatgtctcgttttgatttta |
3851281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 10830528 - 10830577
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| || || ||||||||||| |||||||||||| |
|
|
| T |
10830528 |
aggctaaaatatggttttggtctcttcaaatatgcctagttttggtttta |
10830577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 233
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 18286431 - 18286476
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| | |||||||||||| || |||||||||||| |
|
|
| T |
18286431 |
taaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 32108807 - 32108856
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
32108807 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttagtttta |
32108856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 218
Target Start/End: Original strand, 36278080 - 36278113
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatg |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
36278080 |
aggctaaaatatggttttgatccctgcaaatatg |
36278113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 232
Target Start/End: Complemental strand, 38182090 - 38182041
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
38182090 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 38189041 - 38189090
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
38189041 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 232
Target Start/End: Complemental strand, 38209316 - 38209267
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
38209316 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 38216266 - 38216315
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
38216266 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 38555084 - 38555036
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
38555084 |
aggctaaaatatggtttgg-tccctgcaaatatgcctcattttggtttta |
38555036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 42596814 - 42596769
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagtttta |
42596769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 5104001 - 5103953
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| | |||||||||||| ||| ||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggtttta |
5103953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 229
Target Start/End: Original strand, 6118139 - 6118175
Alignment:
| Q |
193 |
atatggttttaatccctgcaaatatgcctcgttttgg |
229 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| |
|
|
| T |
6118139 |
atatggttttagtctctgcaaatatgcctcgttttgg |
6118175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 15916286 - 15916334
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggtttta |
15916334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 21050575 - 21050623
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||| |||||||| ||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgatttta |
21050623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Original strand, 28213452 - 28213480
Alignment:
| Q |
205 |
tccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28213452 |
tccctgcaaatatgcctcgttttggtttt |
28213480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 234
Target Start/End: Original strand, 32888691 - 32888735
Alignment:
| Q |
190 |
aaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgtttta |
32888735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 36973353 - 36973401
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggtttta |
36973401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 36973710 - 36973662
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| ||||||||| ||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgatttta |
36973662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 5205 - 5257
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5205 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 5225 - 5277
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5225 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 199)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13064469 - 13064417
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13064469 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
13064417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 16712694 - 16712643
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16712694 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16712643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 29380917 - 29380862
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
29380917 |
tttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29380862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 45505897 - 45505846
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45505897 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
45505846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 52017498 - 52017553
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52017498 |
tttataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
52017553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 18205154 - 18205204
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18205154 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18205204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 23778962 - 23779012
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23778962 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
23779012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 29463916 - 29463866
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29463916 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
29463866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 32208540 - 32208590
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32208540 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32208590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 32208903 - 32208853
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32208903 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttgatttta |
32208853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 41345851 - 41345901
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41345851 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
41345901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 52017872 - 52017822
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52017872 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
52017822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 13530722 - 13530665
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13530722 |
tattttaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
13530665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 32365093 - 32365142
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32365093 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32365142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 35763646 - 35763695
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35763646 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35763695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2034859 - 2034807
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
2034859 |
aaaaggctaaaatatggttttagtcccagcaaatatgcctcgttttggtttta |
2034807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2322436 - 2322384
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
2322436 |
aaaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
2322384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 22099543 - 22099591
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22099591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 24774041 - 24774093
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24774041 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24774093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 28809184 - 28809132
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
28809184 |
aaaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
28809132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31560327 - 31560379
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
31560327 |
aaaaggctaaaatatggttttgatccctgcaaatatgcttcgttttggtttta |
31560379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 35415633 - 35415585
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35415585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 38054542 - 38054594
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38054542 |
aaaaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
38054594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 44925481 - 44925533
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
44925481 |
aaaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
44925533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 53717174 - 53717126
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
53717126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 5052587 - 5052536
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5052587 |
aaaggctacaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5052536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 29499179 - 29499230
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29499179 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29499230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 30046795 - 30046744
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30046795 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
30046744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 30061136 - 30061085
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30061136 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
30061085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 43231392 - 43231341
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43231392 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
43231341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 46292654 - 46292603
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
46292654 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
46292603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 2180218 - 2180268
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
2180218 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
2180268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 6827544 - 6827594
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
6827544 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
6827594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 6827876 - 6827826
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6827876 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
6827826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 188 - 230
Target Start/End: Original strand, 16712331 - 16712373
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
16712373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 22099914 - 22099864
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
22099914 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22099864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 23779227 - 23779177
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
23779227 |
aaggctaaaatatggttttaatccctgcaaatatgtctcattttggtttta |
23779177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 24474965 - 24474915
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
24474965 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
24474915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 32365485 - 32365435
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
32365485 |
aaggctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
32365435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 34361801 - 34361851
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
34361801 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
34361851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 45505598 - 45505648
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
45505598 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
45505648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 51545627 - 51545677
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
51545627 |
aaggctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
51545677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 51709029 - 51708979
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
51709029 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
51708979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 55072387 - 55072437
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
55072387 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
55072437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 123533 - 123582
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
123533 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
123582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 8760786 - 8760733
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
8760786 |
taaaaggctaaaatatggttttagtccttgcaaatatggctcgttttggtttta |
8760733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 8904881 - 8904934
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8904881 |
taaaaggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 9289265 - 9289314
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
9289265 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
9289314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 13064158 - 13064207
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
13064158 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
13064207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 13479612 - 13479563
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13479612 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 15555506 - 15555551
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
15555551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 18136126 - 18136065
Alignment:
| Q |
173 |
acattatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
18136126 |
acattatccaaaaggctaaaatatgactttaatccctacaaatatgcctcgttttggtttta |
18136065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 23245596 - 23245547
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
23245596 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
23245547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 26412189 - 26412238
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
26412189 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
26412238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 183 - 232
Target Start/End: Complemental strand, 31182507 - 31182458
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
31182507 |
aaaggctaaaatatggttttaattcctgcaaatatgtctcgttttggttt |
31182458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 41619902 - 41619947
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
41619947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 46088061 - 46088012
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
46088061 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
46088012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 46115784 - 46115731
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
46115784 |
taaaaggctaaaatatggttttagtccctgcaaatacgtctcgttttggtttta |
46115731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 46128918 - 46128865
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
46128918 |
taaaaggctaaaatatggttttagtccctgcaaatacgtctcgttttggtttta |
46128865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 49123334 - 49123273
Alignment:
| Q |
173 |
acattatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
49123334 |
acattatccaaaaggctaaaatatgactttaatccctacaaatatgcctcgttttggtttta |
49123273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 51545966 - 51545921
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
51545921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 51708692 - 51708741
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
51708692 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
51708741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 52442101 - 52442044
Alignment:
| Q |
177 |
tatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| |||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
52442101 |
tatttagaaggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
52442044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 55072709 - 55072664
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
55072664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 185 - 233
Target Start/End: Original strand, 4211560 - 4211608
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4211560 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
4211608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5827977 - 5827925
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
5827977 |
aaaaggctaaaatatggttttggtccctgcaaatatgactcgttttggtttta |
5827925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 11285499 - 11285551
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11285499 |
aaaatgctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
11285551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 185 - 233
Target Start/End: Original strand, 14487801 - 14487849
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14487801 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
14487849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 23245231 - 23245279
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23245279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 25424316 - 25424264
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
25424316 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25424264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 26314336 - 26314284
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
26314336 |
aaaaggctaaaatatggttttgatccctgaaaatatgtctcgttttggtttta |
26314284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 27008084 - 27008132
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
27008132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 35464382 - 35464334
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35464334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 41324890 - 41324842
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggtttta |
41324842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 42848391 - 42848343
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
42848343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 46115414 - 46115462
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
46115462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 46128548 - 46128596
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
46128596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 50714240 - 50714288
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
50714288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 50714565 - 50714517
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
50714517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 14791809 - 14791758
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14791809 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
14791758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 29380664 - 29380715
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||| |||||||||||||| |
|
|
| T |
29380664 |
aaaaggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttt |
29380715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 43231085 - 43231136
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
43231085 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
43231136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 46292392 - 46292439
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
46292439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 8191391 - 8191345
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggttt |
8191345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 8760602 - 8760652
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
8760602 |
aaggctaaaatatagttttactccctgcaaatatgtctcgttttggtttta |
8760652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 9445951 - 9445997
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
9445997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 13631601 - 13631551
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13631601 |
aaggctaaaatatggttttggtccctgcaaatatgactcgttttggtttta |
13631551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 18205521 - 18205475
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
18205475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 25423922 - 25423972
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
25423922 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25423972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 29499548 - 29499498
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29499548 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29499498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 31811923 - 31811973
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31811923 |
aaggctaaaatatggttttgatccctgcaaatatgtatcgttttggtttta |
31811973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 36701998 - 36702048
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
36701998 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
36702048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 41620258 - 41620208
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
41620258 |
aaggctaaaatatggttttagtccctgtaaatatgcatcgttttggtttta |
41620208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 43368459 - 43368513
Alignment:
| Q |
180 |
ttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
43368459 |
ttaaaagactaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
43368513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 45474598 - 45474548
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
45474598 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgctttggtttta |
45474548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 54903477 - 54903427
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
54903477 |
aaggctaaaatatggttttggtccctgcaaatatgccccgttttggtttta |
54903427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 5882551 - 5882599
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
5882551 |
aggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggtttta |
5882599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 9289640 - 9289591
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
9289640 |
aggcttaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
9289591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 12791975 - 12791926
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
12791975 |
aggctaaaatatgatttttgtccctgcaaatatgcctcgttttggtttta |
12791926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 13074126 - 13074077
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
13074126 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggtttta |
13074077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 13631227 - 13631276
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13631227 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13631276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 20291985 - 20292034
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
20291985 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
20292034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 22584286 - 22584335
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
22584286 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
22584335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 28448833 - 28448882
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||||||||||||||| |
|
|
| T |
28448833 |
aggctaaaatatggttttagtccttacaaatatgcctcgttttggtttta |
28448882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 29420538 - 29420489
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
29420538 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
29420489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 35119287 - 35119340
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
35119287 |
taaaaggctaaaatatggttttggtccctgcaaatatgctccgttttggtttta |
35119340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 35415298 - 35415347
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
35415298 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggtttta |
35415347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 35464017 - 35464066
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35464017 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35464066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35763956 - 35763907
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
35763956 |
aggctaaaatatgattttagtccctgcagatatgcctcgttttggtttta |
35763907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 41346219 - 41346170
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
41346219 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
41346170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 45593587 - 45593538
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
45593587 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttggtttta |
45593538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 47023106 - 47023057
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
47023106 |
aggctaaaatatggttttgatccctgcaaatatgtttcgttttggtttta |
47023057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 52430101 - 52430052
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
52430101 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagtttta |
52430052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 52441762 - 52441811
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
52441762 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
52441811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 53716920 - 53716969
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
53716920 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
53716969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 53915682 - 53915731
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
53915682 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
53915731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 53916048 - 53915999
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
53916048 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
53915999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 4279335 - 4279287
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggtttta |
4279287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 12152494 - 12152446
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
12152494 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
12152446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 13073759 - 13073807
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13073807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 26412584 - 26412536
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
26412536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 55482468 - 55482420
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggtttta |
55482420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 191 - 234
Target Start/End: Complemental strand, 123893 - 123850
Alignment:
| Q |
191 |
aaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggtttta |
123850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 2322094 - 2322141
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggtttta |
2322141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 6353637 - 6353590
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggtttta |
6353590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 15555637 - 15555590
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
15555590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 191 - 234
Target Start/End: Complemental strand, 27008401 - 27008358
Alignment:
| Q |
191 |
aaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggtttta |
27008358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 31560702 - 31560647
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
31560702 |
tttaaatggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
31560647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 36702362 - 36702315
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggtttta |
36702315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 42848024 - 42848075
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
42848024 |
aaaggctaaaatatggttttggttcctgcaaatatgtctcgttttggtttta |
42848075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 13764613 - 13764659
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
13764659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 19903653 - 19903607
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19903607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 20144733 - 20144683
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
20144733 |
aaggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 27427870 - 27427919
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||| ||||||||||||||| |
|
|
| T |
27427870 |
aaggctaaaatatggttt-agtccctgcaaatatggctcgttttggtttta |
27427919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 31370798 - 31370852
Alignment:
| Q |
180 |
ttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||||||||||| | |||| |||||||||||||||||||||| |
|
|
| T |
31370798 |
ttaataggctaaaatatggttttagtgtctgcgaatatgcctcgttttggtttta |
31370852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 31812215 - 31812165
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
31812215 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggtttta |
31812165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 36054152 - 36054102
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
36054152 |
aaggctaaaatacggttttggtccctgcaaatatgcctcattttggtttta |
36054102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 41921086 - 41921036
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
41921086 |
aaggctaaaatatggttttagcccctgcaaatatgtttcgttttggtttta |
41921036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 52543420 - 52543470
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
52543420 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 54208827 - 54208777
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
54208827 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
54208777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 4279021 - 4279070
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
4279021 |
aggctaaaatatggttttagcccctgcaaatatatctcgttttggtttta |
4279070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 11693122 - 11693073
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
11693122 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
11693073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 13530378 - 13530427
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
13530378 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgatttta |
13530427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 14488188 - 14488139
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
14488188 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
14488139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 14791502 - 14791547
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
14791547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 20144423 - 20144468
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
20144468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 22584608 - 22584559
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
22584608 |
aggctaaaatgtggttttagtctctgcaaatatgcttcgttttggtttta |
22584559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 24474599 - 24474647
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggtttta |
24474647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 25358213 - 25358258
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25358213 |
gctaaaatatgattttaatccatgcaaatatgcttcgttttggttt |
25358258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 30060772 - 30060817
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgttttta |
30060817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 34355284 - 34355235
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||||||||||||||| |
|
|
| T |
34355284 |
aggctaaaatatggttttagtccctcaaaatatgactcgttttggtttta |
34355235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 42823775 - 42823824
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
42823775 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
42823824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 45593227 - 45593276
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
45593227 |
aggctaaaatatagttttagtccctacaaatatgcctcgttttggcttta |
45593276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 51738136 - 51738185
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
51738136 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
51738185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 2180572 - 2180524
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggtttta |
2180524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 5827655 - 5827703
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
5827703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 19321859 - 19321811
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
19321811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 26313988 - 26314036
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggtttta |
26314036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 28809011 - 28809059
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggtttta |
28809059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 43368777 - 43368729
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| |||||||||||||| |
|
|
| T |
43368777 |
ggctaaaatatggttttaattccggcaaatatgtttcgttttggtttta |
43368729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 47274230 - 47274182
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| |||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggtttta |
47274182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 51738412 - 51738364
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| |||| |
|
|
| T |
51738412 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttgatttt |
51738364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 51763206 - 51763154
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
51763206 |
aaaatgctaaaatatagttttggtccctgcaaatatgcctcattttggtttta |
51763154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 53308068 - 53308020
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggtttta |
53308020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 191 - 234
Target Start/End: Original strand, 2034544 - 2034587
Alignment:
| Q |
191 |
aaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggtttta |
2034587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 9446323 - 9446276
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggtttt |
9446276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 30564830 - 30564881
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| | |||||||||||| |
|
|
| T |
30564830 |
aaagactaaaatatggttttagtccctgcaaatatgttttgttttggtttta |
30564881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 35119612 - 35119565
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
35119612 |
aggctaaaatatggttttggtcactgcaaatatgtctcgttttggttt |
35119565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 36050289 - 36050336
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
36050336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 37557194 - 37557147
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgatttta |
37557147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 44925844 - 44925797
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggtttta |
44925797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 47136170 - 47136123
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
47136123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 54903108 - 54903159
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||||||| |||||| ||||||||| ||||||| |||||| |
|
|
| T |
54903108 |
aaaggttaaaatatggttttgatccctacaaatatgcatcgttttagtttta |
54903159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 227
Target Start/End: Original strand, 5202929 - 5202967
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgtttt |
227 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttt |
5202967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 13764809 - 13764759
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
13764809 |
aaggctaaaatatggttttggtccctgtaaatatgtttcgttttggtttta |
13764759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 18831176 - 18831130
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| || |||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggtttta |
18831130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 28449216 - 28449166
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||| ||||| |
|
|
| T |
28449216 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 217
Target Start/End: Complemental strand, 29060944 - 29060910
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatat |
217 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29060944 |
aaaggctaaaatatgtttttaatccctgcaaatat |
29060910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 47022738 - 47022788
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
47022738 |
aaggataaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
47022788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 5797817 - 5797772
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5797772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 11692761 - 11692810
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||| ||||||| ||||| |
|
|
| T |
11692761 |
aggctaaaatgtggttttggtccctgcaaatatgccccgttttgatttta |
11692810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 226
Target Start/End: Original strand, 12152153 - 12152194
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttt |
226 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
12152153 |
aggctaaaatatggttttggtccctgcaaatatgactcgttt |
12152194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 14594205 - 14594254
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
14594205 |
aggctaaaatatggttttggtccctgcaaatatgtctcactttggtttta |
14594254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 19321569 - 19321618
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| |||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
19321569 |
aggctaaaatatgattttggtccctgtaaacatgcctcgttttggtttta |
19321618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 19903260 - 19903309
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||| ||||| ||||| |
|
|
| T |
19903260 |
aggctaaaatatagttttgatccctgcaaatatgtctcattttgatttta |
19903309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 37556840 - 37556889
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||| ||||| |||||||||| |
|
|
| T |
37556840 |
aggctaaaatatggttttagaccttgcaaatatacctcgatttggtttta |
37556889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 41920771 - 41920816
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||| ||||| |
|
|
| T |
41920771 |
taaaatatggttttagtccctgcaaatatgactcattttgatttta |
41920816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7639892 - 7639944
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| |||||||||||||||| ||||| |||||||| || |||||||||||| |
|
|
| T |
7639892 |
aaaaagctaaaatatggttttggtccctacaaatatgtcttgttttggtttta |
7639944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8191071 - 8191123
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||| || ||||| |||||| |
|
|
| T |
8191071 |
aaaacgctaaaatatgattttaatccctacaaatatgtcttgttttagtttta |
8191123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 8905234 - 8905186
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||| ||||| ||||| |
|
|
| T |
8905234 |
ggctaaaatatggttttggtccctgtaaatatgcctcattttgatttta |
8905186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 25358540 - 25358492
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggtttta |
25358492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Original strand, 36050365 - 36050393
Alignment:
| Q |
205 |
tccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36050365 |
tccctgcaaatatgcctcgttttggtttt |
36050393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 217
Target Start/End: Original strand, 38166494 - 38166526
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatat |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
38166494 |
aggctaaaatatgtttttaatccctgcaaatat |
38166526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 42824091 - 42824043
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || |||||| ||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgatttta |
42824043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 218
Target Start/End: Complemental strand, 50822298 - 50822262
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatg |
218 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
50822298 |
aaaaggctaaaatatggttttactccatgcaaatatg |
50822262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 51830885 - 51830937
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||||||| |||||| |||||||| ||||| || |||||||||||| |
|
|
| T |
51830885 |
aaaagtctaaaatatagttttagtccctgcatatatgtcttgttttggtttta |
51830937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 52543731 - 52543679
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| |||||||||| |||| | | |||||||||||||||||||||||||| |
|
|
| T |
52543731 |
aaaagcctaaaatatgattttggttcttgcaaatatgcctcgttttggtttta |
52543679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 48; Significance: 1e-18; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 4291 - 4240
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4291 |
aaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
4240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 19473 - 19422
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19473 |
aaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
19422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 4040 - 4089
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4040 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 19222 - 19271
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
19222 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 2776 - 2826
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2776 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 366275 - 366225
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
366275 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
366225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 365979 - 366027
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggtttta |
366027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 1306 - 1359
Alignment:
| Q |
181 |
taaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
1306 |
taaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
1359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 1647 - 1596
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
1647 |
aaaggctaaaatatgaatttagtccctgcaaatatgcctcgttttggtttta |
1596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 14696 - 14745
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14696 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 15013 - 14964
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
14964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 3292 - 3243
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3292 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
3243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 9028 - 8980
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 8734 - 8780
Alignment:
| Q |
188 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 3921 - 3870
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3921 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
3870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 3532 - 3580
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
3580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 8649 - 8594
Alignment:
| Q |
179 |
tttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
8649 |
tttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
8594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8326 - 8378
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
8326 |
aaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
8378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 44; Significance: 3e-16; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 54812 - 54863
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
54812 |
aaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
54863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 50075 - 50030
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
50030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 55176 - 55131
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
55131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 5396 - 5447
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
5396 |
aaaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
5447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 5710 - 5660
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
5710 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
5660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 8545 - 8595
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8545 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
8595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 291 - 241
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
291 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 4312 - 4266
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 193 - 234
Target Start/End: Original strand, 4016 - 4057
Alignment:
| Q |
193 |
atatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggtttta |
4057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 82707 - 82658
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
82707 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
82658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 82339 - 82389
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
82339 |
aaggctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
82389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 75765 - 75716
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
75765 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
75716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 75358 - 75407
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
75358 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggtttta |
75407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 94056 - 94105
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
94056 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
187 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 12525 - 12573
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
12573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 34931 - 34979
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggtttta |
34979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 12182 - 12230
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
12230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 12536 - 12488
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
12488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 10168 - 10216
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
10216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 10516 - 10467
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
10516 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggtttta |
10467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 47922 - 47973
Alignment:
| Q |
183 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
47922 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
47973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 48228 - 48183
Alignment:
| Q |
189 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
48183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 223173 - 223124
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
223173 |
aggctaaaatatggttttggtccctgcaaatatgtctcactttggtttta |
223124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 17966 - 17920
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
232 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggttt |
17920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 17646 - 17698
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||| || ||||| |||||| |
|
|
| T |
17646 |
aaaacgctaaaatatgattttaatccctacaaatatgtcttgttttagtttta |
17698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 2661 - 2612
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
2661 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggtttta |
2612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 2333 - 2382
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
2333 |
aggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 24371 - 24420
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
24371 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggtttta |
24420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 27365 - 27316
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
27365 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
27316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Original strand, 27078 - 27106
Alignment:
| Q |
205 |
tccctgcaaatatgcctcgttttggtttt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27078 |
tccctgcaaatatgcctcgttttggtttt |
27106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 18044 - 17995
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
18044 |
aggctaaaatatggttttagtccctgcgaatatgcctcgttttggattta |
17995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 2500 - 2549
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
2500 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttgatttta |
2549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 228
Target Start/End: Complemental strand, 2883 - 2841
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttg |
228 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
2841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 148282 - 148234
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
148234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 22057 - 22007
Alignment:
| Q |
184 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
22057 |
aaggctaaaatatggttttggtcccttcaaatttgcctcgttttggtttta |
22007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 218
Target Start/End: Original strand, 21692 - 21728
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatg |
218 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21692 |
aaaaggctaaaatatggttttgatccctgcaaatatg |
21728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35085 - 35036
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||| ||||||||||||||| |
|
|
| T |
35085 |
aggctaaaatatggttttgatccgtacaaatatgtctcgttttggtttta |
35036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 3751 - 3800
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
3751 |
aggctaaaatatggttttggtccctgcaaatatgctttgttttggtttta |
3800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 4094 - 4031
Alignment:
| Q |
171 |
tcacattatttaaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||| ||||| | ||||||||||| |||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
4094 |
tcacaatattttataggctaaaatacggttttggtccctgcaaatatgtctcgttttagtttta |
4031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 189328 - 189377
Alignment:
| Q |
185 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| ||||| || |||| ||||||||||||||||||||||| |
|
|
| T |
189328 |
aggctaaaatatagttttgattcctgtaaatatgcctcgttttggtttta |
189377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 189682 - 189630
Alignment:
| Q |
182 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||||| ||||| || ||||||||||||||| ||||||||||| |
|
|
| T |
189682 |
aaaaggctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta |
189630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 3455 - 3407
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||| |||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggtttta |
3407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 16724 - 16772
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| ||||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggtttta |
16772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
186 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
234 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| || ||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University