View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850_low_88 (Length: 211)
Name: NF7850_low_88
Description: NF7850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850_low_88 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 211
Target Start/End: Original strand, 2116052 - 2116252
Alignment:
| Q |
11 |
agaatatagttacttaccttttgttttgaagttttcgaaacattagttaataatattattaactaaatctgtaaaatgttgtagtaaaatcaaactataa |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2116052 |
agaatgtagttacttaccttttgttttgaagttttcgaaacattagttaataatattattaactaaacctgtaaaatgttgtagtaaaatcaaactataa |
2116151 |
T |
 |
| Q |
111 |
tataaaagagtgtaagaaatgttttcttttggataattgagctgcattatattgcagtccacgcatgcattgtctccaatatgcaaagtacaaaagctac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2116152 |
tataaaagagtgtaagaaatgttttcttttggataattgagctgcattatattgcagtccacgcatgcattgtctccaatatgcaaagtacaaaagctac |
2116251 |
T |
 |
| Q |
211 |
a |
211 |
Q |
| |
|
| |
|
|
| T |
2116252 |
a |
2116252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University