View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850_low_90 (Length: 201)
Name: NF7850_low_90
Description: NF7850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850_low_90 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 12 - 146
Target Start/End: Original strand, 2985185 - 2985319
Alignment:
| Q |
12 |
aagaatattggctgagccttcattgcattgacacttaaagtcggagccatctcttacacactttccatctccacacaaattaaacaaacaagctgtgtag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2985185 |
aagaatattggctgagccttcattgcattgacacttaaagtcggagccatctcttacacactttccatctccacacaaattaaacaaacatgctgtgtag |
2985284 |
T |
 |
| Q |
112 |
tataaaacactcaaattagcttatgtactaaattt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2985285 |
tataaaacactcaaattagcttatgtactaaattt |
2985319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University