View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7851_high_1 (Length: 365)
Name: NF7851_high_1
Description: NF7851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7851_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 17 - 355
Target Start/End: Original strand, 39535649 - 39535982
Alignment:
| Q |
17 |
atgtagcgcataccagcagacacagaatggtggtactggtagtaggattggaactatttacattttctttttaggctatggataattatgaattaatgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39535649 |
atgtagcgcataccagcagacacagaatggtggtactggtagtaggattggaactatttacattttctttttaggctatggataattatgaattaatgat |
39535748 |
T |
 |
| Q |
117 |
gatgatatagttggagttttatttgattctcattttggttgcacgtgcaaacacatgatgtattgagttagatagatattatttatccaactttgagnnn |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39535749 |
gatgatatagttggagttttattttattctcattttggtttcacgtgcaaacacatgatgtattgagt----tagatattatttatccaactttgagttt |
39535844 |
T |
 |
| Q |
217 |
nnnnccccatttatttgccgcattattttgttcaacgaatagaatgttattactgggactgaattatgtcattgtttcaaattattatgtgttggtggcc |
316 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39535845 |
tttt-cccttttatttgccgcattattttgttcaacccatagaatgttattactgggactgaattatgtcattgtttcaaattattatgtgttggtggcc |
39535943 |
T |
 |
| Q |
317 |
gtggttggtgtcagtatttgtgtccatgcttcacaggtt |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39535944 |
gtggttggtgtcagtatttgtgtccatgcttcacaggtt |
39535982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 276 - 308
Target Start/End: Complemental strand, 24894520 - 24894488
Alignment:
| Q |
276 |
tgaattatgtcattgtttcaaattattatgtgt |
308 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
24894520 |
tgaattatgtcattttttcaaattattatgtgt |
24894488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University