View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7851_high_11 (Length: 220)
Name: NF7851_high_11
Description: NF7851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7851_high_11 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 13211771 - 13211992
Alignment:
| Q |
1 |
tcattcaattttttgagcttgaatcacatccaaaagctccctcaaagggtgagggtgtccaactcggctcttataccatgaaagaattttgtcttgggtt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13211771 |
tcattaaattttttgagcttgaatcacatccaaaagctccctcaaagggtcagggtgtccaactcggctcttataccatgaaaggattttgtcttgggtt |
13211870 |
T |
 |
| Q |
101 |
taatttaaccttacaaaaccggcatgtaaggtgataattgcctccatttacaaac--atgtgtttgccatttctcatccaatgtgagactcttcatatat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13211871 |
taatttaaccttacaaaaccggcatgtaaggtgagaattgcctccacttgcaaacatatgtgcttgccatttctcatccaatgtgagactcttcatatat |
13211970 |
T |
 |
| Q |
199 |
acattcctcatcaaagtaggga |
220 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
13211971 |
acattcctcatcaaattaggga |
13211992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 145
Target Start/End: Original strand, 40169055 - 40169091
Alignment:
| Q |
109 |
ccttacaaaaccggcatgtaaggtgataattgcctcc |
145 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
40169055 |
ccttacaaaaccggcttgtaaggtgagaattgcctcc |
40169091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 145
Target Start/End: Complemental strand, 37223665 - 37223629
Alignment:
| Q |
109 |
ccttacaaaaccggcatgtaaggtgataattgcctcc |
145 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
37223665 |
ccttacaaaaccggcttgtaaggtgatgattgcctcc |
37223629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University