View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7851_high_6 (Length: 273)
Name: NF7851_high_6
Description: NF7851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7851_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 36107839 - 36108009
Alignment:
| Q |
1 |
tgcattgttgcatgttttccnnnnnnnngggactgtccttcagtcatgaatgnnnnnnnggaaaatgataaattttggatgtaccagtaatttttgaaat |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36107839 |
tgcattgttgcatgttttcctcttttttgggactgtccttcagtcatgaatgaaaaaa-ggaaaatgataaattttggatgtaccagtaatttttgaaat |
36107937 |
T |
|
| Q |
101 |
ataagggtcaatttactttcaccatgtttattgtttttattttcacttcaatttataaacattagaggatac |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36107938 |
ataagggtcaatttactttcaccatgtttattgtttttattttcacttcaatttataaacattagaggatac |
36108009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University