View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7851_low_17 (Length: 317)
Name: NF7851_low_17
Description: NF7851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7851_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 46 - 273
Target Start/End: Complemental strand, 25606353 - 25606125
Alignment:
| Q |
46 |
tggtatttgagtgtaatctcatgtattttctttctagaatgtactcaaatataaatagttgtaaattcaactcacatttaatcctaataaacttacttta |
145 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
25606353 |
tggtatttgagtgtaatctcgtgtattttcgatctagaatgtactcaaatataaatagttgtaaattcaactcacatttaatcccaataaacttaattta |
25606254 |
T |
 |
| Q |
146 |
cataattaattttgtcaccgtagaataaattgtgcat-gtttaaaatcgcattgaatttaacatgcagtaacacaccaaagcaaactaatgttatctaat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25606253 |
cataattaattttgtcaccgtagaataaattgtgcatcttttaaaatcgcattgaatttaacatgcagtaacacaccagagcaaactaatgttatctaat |
25606154 |
T |
 |
| Q |
245 |
gaattatttagggacataaagttacatca |
273 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25606153 |
gaattatttagggacataaagttacatca |
25606125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University