View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7851_low_18 (Length: 309)
Name: NF7851_low_18
Description: NF7851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7851_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 12 - 217
Target Start/End: Original strand, 25988136 - 25988339
Alignment:
| Q |
12 |
atggacatcactttcagatcatgcatatttagatatatcgttgtttgataaacaagaagggtgtgctatttctagttaaagaaactttgtcaaaagaaaa |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988136 |
atggacaacactttcagatcatgcatatttggatatatcgttgtttgataaacaagaagggtgtgctatttctagttaaagaaactttgtcaaaagaaaa |
25988235 |
T |
|
| Q |
112 |
aagtcccacataaagatttatggaaagcacaaaatttacatggtacagttccatcttttcttggtcttccctacctgtgtcatgtgctgagtaccatgtc |
211 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25988236 |
aagtccaacataaagatttatggaaagcccaaaatttacatggtacagttccatcttttcttggtcttccctacc--tgtcatgtgctgagtaccatgtc |
25988333 |
T |
|
| Q |
212 |
tttcaa |
217 |
Q |
| |
|
| |||| |
|
|
| T |
25988334 |
tctcaa |
25988339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 193 - 293
Target Start/End: Original strand, 25988421 - 25988522
Alignment:
| Q |
193 |
atgtgctgagtaccatgtctttcaagttccttaaatattnnnnnnnnnnnnn-tcatacatcgtttgatcttgatataatggttattgtgttctaatgga |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988421 |
atgtgctgagtaccatgtctttcaagttccttaaatattaaaaagaaaaaaaatcatacatcgtttgatcttgatataatggttattgtgttctaatgga |
25988520 |
T |
|
| Q |
292 |
tc |
293 |
Q |
| |
|
|| |
|
|
| T |
25988521 |
tc |
25988522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University