View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7851_low_31 (Length: 228)
Name: NF7851_low_31
Description: NF7851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7851_low_31 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 40484405 - 40484177
Alignment:
| Q |
1 |
tcacagaagatcctttaagagtggtatggataatcagataatgtgatagt-taagacttcttgtaggacaaatttacataccagcctcctctgctaacag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40484405 |
tcacagaagatcctttaagagtggtatggataatcatataatgtgatagtgtaagacttcttgtaggacaaatttacataccagcctcctctgctaacag |
40484306 |
T |
 |
| Q |
100 |
tatccttttcaaatgaaagcttccaatcttgtcgataaccttccatatacaattctattattttaagacctgcctgtagtgcaacagctaaaattaacac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40484305 |
tatccttttcaaatgaaagcttccaatcttgtcgataaccttccatatacaattctattattttaagacctgcctgtagtgcaacagctaaaattaacac |
40484206 |
T |
 |
| Q |
200 |
gggatcctttgtatatctaacaacaactt |
228 |
Q |
| |
|
|||||||||||||||| |||||| ||||| |
|
|
| T |
40484205 |
gggatcctttgtatatttaacaaaaactt |
40484177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University