View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7852_high_4 (Length: 224)

Name: NF7852_high_4
Description: NF7852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7852_high_4
NF7852_high_4
[»] chr1 (1 HSPs)
chr1 (1-215)||(8016561-8016772)


Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 8016772 - 8016561
Alignment:
1 ctcttcttcaccatgttgctgatgcaatgtcttctgaaatgcgggctgggctttcctccgttgatgggcccgggcttcccatgataccaacttatgtcca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8016772 ctcttcttcaccatgttgctgatgcaatgtcttctgaaatgcgggctgggctttcctccgttgatgggcccgggcttcccatgataccaacttatgtcca 8016673  T
101 cactcttccctccgggtatgtatgtcgtatgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttattattattga 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||    
8016672 cactcttccctccgggtatgtatgtcgtatgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttat---tattga 8016576  T
201 catgatgatgatgat 215  Q
    |||||||||||||||    
8016575 catgatgatgatgat 8016561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University