View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7852_high_4 (Length: 224)
Name: NF7852_high_4
Description: NF7852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7852_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 8016772 - 8016561
Alignment:
| Q |
1 |
ctcttcttcaccatgttgctgatgcaatgtcttctgaaatgcgggctgggctttcctccgttgatgggcccgggcttcccatgataccaacttatgtcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016772 |
ctcttcttcaccatgttgctgatgcaatgtcttctgaaatgcgggctgggctttcctccgttgatgggcccgggcttcccatgataccaacttatgtcca |
8016673 |
T |
 |
| Q |
101 |
cactcttccctccgggtatgtatgtcgtatgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttattattattga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8016672 |
cactcttccctccgggtatgtatgtcgtatgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttat---tattga |
8016576 |
T |
 |
| Q |
201 |
catgatgatgatgat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8016575 |
catgatgatgatgat |
8016561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University