View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7852_low_3 (Length: 404)
Name: NF7852_low_3
Description: NF7852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7852_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 25 - 389
Target Start/End: Complemental strand, 44236250 - 44235886
Alignment:
| Q |
25 |
ccttttgtctctgaaactctaacgaaataacacttttatcatcaccaacaaaagaacttgtcttctgaggttgtggtggtggaggctgagaaggaggtga |
124 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44236250 |
ccttttgtctctgaaactctaacgaaacaacacttttatcatcaccaacaaaagaacttgtcttctgaggttgtggtggtggaggctgagaaggaggtga |
44236151 |
T |
 |
| Q |
125 |
aggtttcaaaggttgaggaagattagacggttctttcacagaaggggccgctggtcttctcaaaggaccatcattctgaacattccttatagtaacagca |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44236150 |
aggtttcaaaggttgaggaagattagacggttctttcacagaaggagccgctggtcttctcaaaggaccatcattctgaacattccttatagtaacagca |
44236051 |
T |
 |
| Q |
225 |
taaagcttggaagaagagaatctaaaagaataagatgaagttgaacaagaagaggaagatgaatgagttgttgggattttgatgcatgggattgaagatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44236050 |
taaagcttggaagaagagaatctaaaagaataagatgaagttgaacaagaagaggaagatgaatgagttgttgggattttgatgcatgggattgaagatg |
44235951 |
T |
 |
| Q |
325 |
ttacagacatgnnnnnnnggggggattgatgaatttgatttgttttgtgtatttatctttgttct |
389 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44235950 |
ttacagacatgtttttttggggggattgatgaatttgatttgttttgtgtatttatctttgttct |
44235886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University