View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7853_high_10 (Length: 257)

Name: NF7853_high_10
Description: NF7853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7853_high_10
NF7853_high_10
[»] chr8 (1 HSPs)
chr8 (21-257)||(44299166-44299402)


Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 21 - 257
Target Start/End: Original strand, 44299166 - 44299402
Alignment:
21 gaatctggcatcacgtgcatgtaaccggtagcgagtataacaccggaggcaaaagccttaacgatcacgaataaatctccgtcgggttttaacgctggga 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||    
44299166 gaatctggcatcacgtgcatgtaaccggtagcgagtataacaccggaggcaaaagccttaatgatcacgaataaatctccgtcgggttttaatgctggga 44299265  T
121 tcgaagttgtgaaaattggaatacaaattccaatcatgctcgtcactaatatggaaaatattgcaattaattttagctttagtgcttcatttttgttgtg 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44299266 tcgaagttgtgaaaattggaatacaaattccaatcatgctcgtcactaatatggaaaatattgcaattaattttagctttagtgcttcatttttgttgtg 44299365  T
221 acatacaccttcatatttggacgagcactctgattca 257  Q
    |||||||||||||||||||||||||||||||||||||    
44299366 acatacaccttcatatttggacgagcactctgattca 44299402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University