View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7853_low_11 (Length: 257)
Name: NF7853_low_11
Description: NF7853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7853_low_11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 21 - 257
Target Start/End: Original strand, 44299166 - 44299402
Alignment:
| Q |
21 |
gaatctggcatcacgtgcatgtaaccggtagcgagtataacaccggaggcaaaagccttaacgatcacgaataaatctccgtcgggttttaacgctggga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44299166 |
gaatctggcatcacgtgcatgtaaccggtagcgagtataacaccggaggcaaaagccttaatgatcacgaataaatctccgtcgggttttaatgctggga |
44299265 |
T |
 |
| Q |
121 |
tcgaagttgtgaaaattggaatacaaattccaatcatgctcgtcactaatatggaaaatattgcaattaattttagctttagtgcttcatttttgttgtg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44299266 |
tcgaagttgtgaaaattggaatacaaattccaatcatgctcgtcactaatatggaaaatattgcaattaattttagctttagtgcttcatttttgttgtg |
44299365 |
T |
 |
| Q |
221 |
acatacaccttcatatttggacgagcactctgattca |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44299366 |
acatacaccttcatatttggacgagcactctgattca |
44299402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University