View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7853_low_14 (Length: 235)

Name: NF7853_low_14
Description: NF7853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7853_low_14
NF7853_low_14
[»] chr1 (1 HSPs)
chr1 (17-220)||(6485510-6485713)
[»] chr4 (1 HSPs)
chr4 (110-149)||(25702695-25702734)


Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 6485713 - 6485510
Alignment:
17 gtggtaaagcaacaaaacatgtaatggttaaacaacttttaaaacaagaatgtgcagtaactgctttagcaattgacagcacaggttcaatggtttattg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6485713 gtggtaaagcaacaaaacatgtaatggttaaacaacttttaaaacaagaatgtgcagtaactgctttagcaattgacagcacaggttcaatggtttattg 6485614  T
117 tggtgcttctgatggattggttaacttttgggaacgtgataaacaatttgaacatggtggggtcctcaagggtcataagcttgcagttttgtgtttagct 216  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
6485613 tggtgcttctgatggattggttaacttttgggaacgtgataagcaatttgaacatggtggagtcctcaagggtcataagcttgcagttttgtgtttagct 6485514  T
217 tctg 220  Q
    ||||    
6485513 tctg 6485510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 110 - 149
Target Start/End: Complemental strand, 25702734 - 25702695
Alignment:
110 tttattgtggtgcttctgatggattggttaacttttggga 149  Q
    ||||||| ||| ||||||||||||||||||||||||||||    
25702734 tttattgcggttcttctgatggattggttaacttttggga 25702695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University