View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7853_low_5 (Length: 355)
Name: NF7853_low_5
Description: NF7853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7853_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 9e-52; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 16 - 131
Target Start/End: Complemental strand, 43586990 - 43586875
Alignment:
| Q |
16 |
cgatgttggcaggatagtggaagagtttagtcctctccaaggtttaagatggacttttgatttaaaccttgatatataattaaccattgtaggagagtaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43586990 |
cgatgttggcaggatagtggaagagtttagtcctctccaaggtttaagatagacttttgatttaaaccttgatatataagtaaccattgtaggagagtaa |
43586891 |
T |
 |
| Q |
116 |
acagaaaaaagatttg |
131 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
43586890 |
acagaaaaaggatttg |
43586875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 247 - 346
Target Start/End: Complemental strand, 43586754 - 43586655
Alignment:
| Q |
247 |
gttgtcaaggatcaagtttcttgttggaacatgacaacttcgtccacccccaaaaatattattacacccctccaaatgttattgtttttcggtgatgtcc |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43586754 |
gttgtcaaggatcaagtttcttgttggaacatgacaacttcgtccacccccaaaaatattattacacccctccaaatgttattgtttttcggtgatgtcc |
43586655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 129 - 182
Target Start/End: Complemental strand, 43586834 - 43586781
Alignment:
| Q |
129 |
ttgacttaatgggcatatccaagaacaactcaagagtgtccttcaccaaatgag |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43586834 |
ttgacttaatgggcatatccaagaacaactcaagagtgtccttcaccaaatgag |
43586781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 263 - 343
Target Start/End: Original strand, 49605473 - 49605553
Alignment:
| Q |
263 |
tttcttgttggaacatgacaacttcgtccacccccaaaaatattattacacccctccaaatgttattgtttttcggtgatg |
343 |
Q |
| |
|
|||| |||||||||||||||| ||| | ||| | ||||| ||||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
49605473 |
tttcctgttggaacatgacaaagtcgccaacctctaaaaacattattacacccctcaaaatgttactgtttgtcggtgatg |
49605553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University