View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7855_high_12 (Length: 252)
Name: NF7855_high_12
Description: NF7855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7855_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 45 - 241
Target Start/End: Complemental strand, 45266913 - 45266720
Alignment:
| Q |
45 |
tgagtgcatgattgttattacggtgacttggagaaaatgacagtgccaacaccataattttattgaagctacaaagtgtgactttagtcaattcaccgtg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
45266913 |
tgagtgcatgattgttattacggtgacttagagaaaatgacagtgcca---ccataattttattgaagctacaaagtgtaactttggtcaattcaccgtg |
45266817 |
T |
 |
| Q |
145 |
ataccaaacaagcatcaagttaaatgtagggtatacaagaaatatgatccatacctgatatttttaaattttaggtgaaaatgtggtgttgatgtcc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45266816 |
ataccaaacaagcatcaagttaaatgtagggtatacaagaaatatgatccatacctgatatttttaaattttaggtgaaaatgtggtgtcgatgtcc |
45266720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University