View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7855_high_9 (Length: 285)
Name: NF7855_high_9
Description: NF7855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7855_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 78 - 280
Target Start/End: Original strand, 7284993 - 7285195
Alignment:
| Q |
78 |
aagggtttatgtctctaattacggcttcctccacttcaacatggaaactcatcttcacaatttaacttgcgagttataacccattaaaagctagaatctt |
177 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7284993 |
aaggctttatgtctctaattacggcttcctccacttcaacatggaaactcatcttcacaatttaacttgcgagttataacccattaaaagctagaatctt |
7285092 |
T |
 |
| Q |
178 |
gaagatgaagaaatgtagaaaacaaatacctagagaattgattttaaggccatcattgatgtgcttcatgtggccattgagaccacataacttaacacca |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7285093 |
gaagatgaagaaatgtagaaaacaaatacctagagaattgattttaaggccatcattgatgtgcttcatgtggccattgagaccacataacttaacacca |
7285192 |
T |
 |
| Q |
278 |
aac |
280 |
Q |
| |
|
||| |
|
|
| T |
7285193 |
aac |
7285195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 81
Target Start/End: Original strand, 7284883 - 7284944
Alignment:
| Q |
20 |
aatgttacataaccaatgagcctatgcaaaaatttgaagtgctaaataaagaataattaagg |
81 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7284883 |
aatgttacataaccaatgagcctatgcggaaatttgaagtgctaaataaagaataattaagg |
7284944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University