View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7855_low_12 (Length: 318)
Name: NF7855_low_12
Description: NF7855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7855_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 16 - 301
Target Start/End: Complemental strand, 15416663 - 15416378
Alignment:
| Q |
16 |
atcagctggtgaagatgaggaagatgtctatgctgatctttacctagtgaaatggactagtctcttcattatgccactaacaattattattgtcaatatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15416663 |
atcagctggtgaagatgaggaagatgtctatgctgatctttacctagtgaaatggactagtctcttcattatgccactaacaattattattgtcaatatt |
15416564 |
T |
 |
| Q |
116 |
gttgcacttatcatgggatttttaaggacagtatacagtgttatacctcagtggaacaagcttatgggaggtacattctttagtttttgggtcttgtctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15416563 |
gttgcacttatcatgggatttttaaggacagtatacagtgttatacctcagtggaacaagcttatgggaggtacattctttagtttttgggtcttgtctc |
15416464 |
T |
 |
| Q |
216 |
atatgtacccttttgctaaagggttgatgggtagaagaggaagggttccaacaattgtttatgtttggtcagggttgctttctatt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15416463 |
atatgtacccttttgctaaagggttgatgggtagaagaggaagggttccaacaattgtttatgtttggtcagggttgctttctatt |
15416378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 287
Target Start/End: Complemental strand, 12192090 - 12191993
Alignment:
| Q |
190 |
attctttagtttttgggtcttgtctcatatgtacccttttgctaaagggttgatgggtagaagaggaagggttccaacaattgtttatgtttggtcag |
287 |
Q |
| |
|
|||||| ||||||||||| ||| ||||| | || || ||||| |||||| | |||||||||||||| || ||||||||||| | ||||||||||| |
|
|
| T |
12192090 |
attcttcagtttttgggtattggctcatttatatccatttgcaaaagggcttatgggtagaagaggtagaacaccaacaattgtgtttgtttggtcag |
12191993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 191 - 255
Target Start/End: Complemental strand, 29916743 - 29916679
Alignment:
| Q |
191 |
ttctttagtttttgggtcttgtctcatatgtacccttttgctaaagggttgatgggtagaagagg |
255 |
Q |
| |
|
||||| || |||||||||||| ||||| | || |||||||| ||||| |||||||| |||||||| |
|
|
| T |
29916743 |
ttcttcagcttttgggtcttggctcatctctatccttttgcaaaaggtttgatgggaagaagagg |
29916679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University