View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7855_low_21 (Length: 239)
Name: NF7855_low_21
Description: NF7855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7855_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 12 - 218
Target Start/End: Original strand, 3899028 - 3899233
Alignment:
| Q |
12 |
aagaatatcgtggctgggaaggagtaagggatatttaatgtaaaaaatgatgaattaaggcattaatcaatcggtattatattataatgctgtgaattta |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3899028 |
aagaatgtcgtggctgggaaggagtaagggatatt-aatgtaaaaaataatgaattaaggcattaatcaatcggtattatattataatgctgtgaattta |
3899126 |
T |
 |
| Q |
112 |
tgtttctcaactttcataatacatatatgtttgttaacatgtgctgcataattccctcaagaaattgattgttatatgtactcttttgacaacaacaata |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3899127 |
tgtttctcaactttcataatacagatatgtttgttaacatgtgctgcataattccctcaagaaattgattgttatatgtactcttttgacaacaacaaca |
3899226 |
T |
 |
| Q |
212 |
ataataa |
218 |
Q |
| |
|
||||||| |
|
|
| T |
3899227 |
ataataa |
3899233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University