View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7855_low_9 (Length: 384)

Name: NF7855_low_9
Description: NF7855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7855_low_9
NF7855_low_9
[»] chr4 (3 HSPs)
chr4 (218-367)||(48431006-48431155)
chr4 (112-179)||(48431199-48431266)
chr4 (24-62)||(48431263-48431301)
[»] chr3 (1 HSPs)
chr3 (283-319)||(52806042-52806078)


Alignment Details
Target: chr4 (Bit Score: 134; Significance: 1e-69; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 218 - 367
Target Start/End: Complemental strand, 48431155 - 48431006
Alignment:
218 gagctttctctggtcatacttaaactccatctagttgaccttctctttagaggtgtgccccagaagcctcttccttattattggtacggctatgagaggg 317  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
48431155 gagctttctttggtcatacttaaactccatctagttgaccttctctttagaggtgtgcccccgaagcctcttccttattattggtacggctatgagaggg 48431056  T
318 ctttttccggtcattcaacttctaaatctggccatttgagggctaaatct 367  Q
    |||||||||||||||||||| |||| ||||||||||||||||||||||||    
48431055 ctttttccggtcattcaactgctaagtctggccatttgagggctaaatct 48431006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 112 - 179
Target Start/End: Complemental strand, 48431266 - 48431199
Alignment:
112 atttcattcattgttattttagtatattaatgtcatgtagtcctacactgatttgtgctttcattccc 179  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
48431266 atttcattcattgttattttagtatattaatgtcatgtcgtcctacactgatttgtgctttcattccc 48431199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 24 - 62
Target Start/End: Complemental strand, 48431301 - 48431263
Alignment:
24 aagaaggaatgtgtgggcatgaatttgagtattaaattt 62  Q
    |||||||||||||||||||||||||||||||| ||||||    
48431301 aagaaggaatgtgtgggcatgaatttgagtatcaaattt 48431263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 319
Target Start/End: Complemental strand, 52806078 - 52806042
Alignment:
283 gcctcttccttattattggtacggctatgagagggct 319  Q
    |||||||||||||||||||| |||||||| |||||||    
52806078 gcctcttccttattattggtccggctatgtgagggct 52806042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University