View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7855_low_9 (Length: 384)
Name: NF7855_low_9
Description: NF7855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7855_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 1e-69; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 218 - 367
Target Start/End: Complemental strand, 48431155 - 48431006
Alignment:
| Q |
218 |
gagctttctctggtcatacttaaactccatctagttgaccttctctttagaggtgtgccccagaagcctcttccttattattggtacggctatgagaggg |
317 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48431155 |
gagctttctttggtcatacttaaactccatctagttgaccttctctttagaggtgtgcccccgaagcctcttccttattattggtacggctatgagaggg |
48431056 |
T |
|
| Q |
318 |
ctttttccggtcattcaacttctaaatctggccatttgagggctaaatct |
367 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
48431055 |
ctttttccggtcattcaactgctaagtctggccatttgagggctaaatct |
48431006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 112 - 179
Target Start/End: Complemental strand, 48431266 - 48431199
Alignment:
| Q |
112 |
atttcattcattgttattttagtatattaatgtcatgtagtcctacactgatttgtgctttcattccc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48431266 |
atttcattcattgttattttagtatattaatgtcatgtcgtcctacactgatttgtgctttcattccc |
48431199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 24 - 62
Target Start/End: Complemental strand, 48431301 - 48431263
Alignment:
| Q |
24 |
aagaaggaatgtgtgggcatgaatttgagtattaaattt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48431301 |
aagaaggaatgtgtgggcatgaatttgagtatcaaattt |
48431263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 319
Target Start/End: Complemental strand, 52806078 - 52806042
Alignment:
| Q |
283 |
gcctcttccttattattggtacggctatgagagggct |
319 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
52806078 |
gcctcttccttattattggtccggctatgtgagggct |
52806042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University