View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7856_low_4 (Length: 298)
Name: NF7856_low_4
Description: NF7856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7856_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 26 - 271
Target Start/End: Complemental strand, 21160466 - 21160221
Alignment:
| Q |
26 |
gacaaataagtgtacgtgattggagagaaaaagatgcattaacacattaatagagtaagacatcaccctttaaagtgggtaaccaatctacaactaatac |
125 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21160466 |
gacaaataagtgtacgtgatttgagagaaaaagatgcattaacacattaatagagtaagacatcaccctttaaagtgggtaaccaatctacaactaatac |
21160367 |
T |
 |
| Q |
126 |
aaagttttgtgcttccacccttttgactttatacccaaattacannnnnnncttacaaaaacgtgtgtaccagttttgtggccttcatttctctagtaag |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21160366 |
aaagttttgtgcttccacccttttgactttatacccaaattatagggggggcttacaaaaacgtgtgtaccagttttgtggccttcatttctctagtaag |
21160267 |
T |
 |
| Q |
226 |
gtgtcacgtgattgttttcaagctatttggtgaatttgtgcttgag |
271 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21160266 |
gagtcacgtgattgttttcaagctatttggtgaatttgtgcttgag |
21160221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University