View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7857_high_3 (Length: 279)
Name: NF7857_high_3
Description: NF7857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7857_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 135 - 261
Target Start/End: Complemental strand, 29580604 - 29580478
Alignment:
| Q |
135 |
acttgtattgtctcaaaaaatatgtaaaatgttaaccgagttctgcatctaggtcctactgggaaactcaattgatgatttggcggagacggtaggactt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29580604 |
acttgtattgtctcaaaaaatatgtaaaatgttaaccgagttctgcatctaggtcctactgggaaactcaattgatgatttggcggagacggtaggactt |
29580505 |
T |
 |
| Q |
235 |
gtaaccatgaggtctagagtttaaatc |
261 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
29580504 |
gtaaccatgaggtctagagttcaaatc |
29580478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 16 - 70
Target Start/End: Complemental strand, 29580723 - 29580669
Alignment:
| Q |
16 |
aaaggcaggaggttgcaaccatttgaatcctttagcttaaaatcaagtgtaggaa |
70 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29580723 |
aaaggcaggaggttgtaaccatttgaatcctttagcttaaaatcaaatgtaggaa |
29580669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University