View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7857_high_5 (Length: 238)
Name: NF7857_high_5
Description: NF7857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7857_high_5 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 238
Target Start/End: Original strand, 473959 - 474184
Alignment:
| Q |
13 |
atcatcaccgccacaaatctactgcatgtgttcagagaatgccagtacttcgtcgtcctgctccggtaagccgtgaaaaatccgaacttgtgccgctatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
473959 |
atcatcaccgccacaaatctactgcatgtgttcagagaatgccagtacttcgtcgtcctgctccggtaagccgtgaaaaatccgaacttgtgccgctatc |
474058 |
T |
 |
| Q |
113 |
gcggcggctaggaaaaaagagcagaaggaaccgtttattgagatatttgagcctgataacttggtaagagaagaggtagaagaaattgaaggggtgatgg |
212 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
474059 |
gcggcgactaggaaaaaagagcagaaggaaccgtttattgagatatttgagcctgataacttggtaagagaagaggtagaagaaattgaaggggtgatgg |
474158 |
T |
 |
| Q |
213 |
gtgatgaaagtggtggtttgagtgct |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
474159 |
gtgatgaaagtggtggtttgagtgct |
474184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University