View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7857_low_1 (Length: 376)
Name: NF7857_low_1
Description: NF7857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7857_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 18 - 365
Target Start/End: Complemental strand, 474506 - 474161
Alignment:
| Q |
18 |
ataaatctataccaacatttatccgatcaaaatcaagataccataaataataaattcattctaattaaaacatgatccaaactctcttgactacatgttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
474506 |
ataaatctataccaacatttatccgatcaaaatcaagataccataaataataaattcattctaattaaaacatgatccaaactctcttgactacatgttg |
474407 |
T |
 |
| Q |
118 |
taggaacaattgatatgctagattgcgggtttaacccgccatttatccctacttctctgcatttagtgtgttaatttcacggctagctcataaaaaccaa |
217 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
474406 |
taggagcaattgatatgctggattgcgggtttaacccaccatttatccctacttctctgcatttagtgtgttaatttcacggctagctcataaaaaccaa |
474307 |
T |
 |
| Q |
218 |
acnnnnnnnnnncatgatctaaagcatttgcatgccatgaaaaaattgaacaaactcataggacacataccctctcaggaaaaggggtagtattgccctc |
317 |
Q |
| |
|
|| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
474306 |
ac-aaaaaaaaacatgatctaaagcatttgcatgccatg-aaaaattgaacaaactcataggacacataccctctcaggaaaaggggtagtattgccctc |
474209 |
T |
 |
| Q |
318 |
atcctcttgagcaacacctttattagcactcaaaccaccactttcatc |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
474208 |
atcctcttgagcaacacctttattagcactcaaaccaccactttcatc |
474161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University