View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7858_low_4 (Length: 239)
Name: NF7858_low_4
Description: NF7858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7858_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 26 - 158
Target Start/End: Complemental strand, 14007436 - 14007299
Alignment:
| Q |
26 |
ttacatggaaatgtcnnnnnnnaatagtgattcttgttggatacaatataaa-------ccacacatgcagaaggtctcaagaaccttaatgatatcttg |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14007436 |
ttacatggaaatgtctttttttaatagtgattcttgttggatacaatataaattataaaccacacatgcagaaggtctcaagaaccttaatgat--cttg |
14007339 |
T |
|
| Q |
119 |
tatctcacactaaatttatgagtaactgatgttcaattat |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14007338 |
tatctcacactaaatttatgagtaactgatgttcaattat |
14007299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 171 - 224
Target Start/End: Complemental strand, 14006971 - 14006918
Alignment:
| Q |
171 |
tttaagaaaaagagcaatgttattcattgccaagaaaaaacgaacgaaataatt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14006971 |
tttaagaaaaagagcaatgttattcattgccaagaaaaaagcaacgaaataatt |
14006918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University