View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7860_low_12 (Length: 231)
Name: NF7860_low_12
Description: NF7860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7860_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 13 - 175
Target Start/End: Original strand, 9576281 - 9576443
Alignment:
| Q |
13 |
gagaagaagaagtaagcgtgggtgaaaggttttattccgagtattggggttttggtcttctgaaggttgctctgattaagtttttgtttggggataggtg |
112 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9576281 |
gagaggaagaagtaagtgtgggtgaaaggttttattccgagtattggggttttggtcttctgaaggttgctctgattaagtttttgtttggggataggtg |
9576380 |
T |
|
| Q |
113 |
gtgtgatttagctcatttacgagttgaataaaggttggatcatatggtgtaggggcagcatag |
175 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9576381 |
gtgtgagttagctcatttgcgagttgaataaaggttggatcatatggtgtaggggcagcatag |
9576443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 213
Target Start/End: Original strand, 9576527 - 9576555
Alignment:
| Q |
185 |
aaaaaagggaaaatattttcttcaaaaat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9576527 |
aaaaaagggaaaatattttcttcaaaaat |
9576555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University