View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7861_low_22 (Length: 423)

Name: NF7861_low_22
Description: NF7861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7861_low_22
NF7861_low_22
[»] chr5 (1 HSPs)
chr5 (8-61)||(12355218-12355271)


Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 8 - 61
Target Start/End: Complemental strand, 12355271 - 12355218
Alignment:
8 tggacatcaacaatctggtagaaaataggtggttctatgtcgtctaccttattg 61  Q
    ||||| |||| |||||||||||||||||||||||||||| ||||||||||||||    
12355271 tggacttcaataatctggtagaaaataggtggttctatgccgtctaccttattg 12355218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University