View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7861_low_32 (Length: 332)
Name: NF7861_low_32
Description: NF7861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7861_low_32 |
 |  |
|
| [»] scaffold0886 (1 HSPs) |
 |  |  |
|
| [»] scaffold0196 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0437 (2 HSPs) |
 |  |  |
|
| [»] scaffold0068 (1 HSPs) |
 |  |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
| [»] scaffold0062 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0291 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 262; Significance: 1e-146; HSPs: 16)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 20 - 322
Target Start/End: Original strand, 22705085 - 22705387
Alignment:
| Q |
20 |
aaggcagttgataagttggctaatatagatatgcactacagggttcaatttgattgacgactttttgtccagaattgaactttgatttctttcagaacaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22705085 |
aaggcagttgataagttggctaatatagatatgcactacagggttcaatttgattgacgactttttctccagaattgaactttgatttctttcagaacaa |
22705184 |
T |
 |
| Q |
120 |
atgcggtctgcctaattacagattcccctagtctattggtttccgtttcctttttctttcttgttttgagagttttagcctaatcctccctctttgtata |
219 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22705185 |
atacggtctgcctaattacagattcccctagtctattggtttccgtttcctttttctttcttgttttgagagttttagcctaatcccccctctttgtata |
22705284 |
T |
 |
| Q |
220 |
tattttccccccnnnnnnnaataatattttgatcttgacagtataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttga |
319 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22705285 |
tattttcccccctttttttaataatattttgatcttgacggtataggatggatgtttatcgaggtgccaacctagttgggatgtcggtgttacctcttga |
22705384 |
T |
 |
| Q |
320 |
tgt |
322 |
Q |
| |
|
||| |
|
|
| T |
22705385 |
tgt |
22705387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 262 - 323
Target Start/End: Complemental strand, 24127890 - 24127829
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||| |||| ||||| ||||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
24127890 |
ataggatggaggtttctcgaggtgccaacctagctgggatgtcgatgatacctcttgatgtc |
24127829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 321
Target Start/End: Complemental strand, 15141950 - 15141911
Alignment:
| Q |
282 |
gttgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15141950 |
gttgccaacctagttgggatgtcggtgtttcctcttgatg |
15141911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 284 - 322
Target Start/End: Original strand, 14641470 - 14641508
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatgt |
322 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14641470 |
tgccaacctagttgggatgtcggtgttccctcttgatgt |
14641508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 262 - 323
Target Start/End: Original strand, 8462019 - 8462080
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||| || | ||||| |||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
8462019 |
ataggatggaggtctctcgaggtgccaacctagttgggatgtcgatgatgcctcttgatgtc |
8462080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 260 - 321
Target Start/End: Original strand, 13570475 - 13570536
Alignment:
| Q |
260 |
gtataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||||||| |||||| ||| | |||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
13570475 |
gtataggatgaatgtttctcggggtgccaatctagttgggatgtaggtgttccctcttgatg |
13570536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 321
Target Start/End: Original strand, 13575035 - 13575072
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13575035 |
tgccaacctagttgggatgtcggtgttccctcttgatg |
13575072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 321
Target Start/End: Original strand, 13577574 - 13577611
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13577574 |
tgccaacctagttgggatgtcggtgttccctcttgatg |
13577611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 321
Target Start/End: Original strand, 20898996 - 20899033
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20898996 |
tgccaacctagttgggatgtcggtgttgcctcttgatg |
20899033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 321
Target Start/End: Complemental strand, 24617777 - 24617740
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24617777 |
tgccaacctagttgggatgtcggtgtttcctcttgatg |
24617740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 284 - 323
Target Start/End: Complemental strand, 14372230 - 14372191
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
14372230 |
tgccaacctagttgggatgtcgatgttgcctcttgatgtc |
14372191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 321
Target Start/End: Complemental strand, 8483676 - 8483639
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
8483676 |
tgccaacctagttgggatgtccgtgtttcctcttgatg |
8483639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 321
Target Start/End: Original strand, 13565947 - 13565984
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
13565947 |
tgccaacctagttgggatgtcgttgttccctcttgatg |
13565984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 305
Target Start/End: Original strand, 30884410 - 30884455
Alignment:
| Q |
260 |
gtataggatggatgtttatcgagttgccaacctagttgggatgtcg |
305 |
Q |
| |
|
|||||||||||| |||||||| | || ||||||||||||||||||| |
|
|
| T |
30884410 |
gtataggatggaagtttatcggggtgtcaacctagttgggatgtcg |
30884455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 262 - 310
Target Start/End: Complemental strand, 9351190 - 9351142
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgtt |
310 |
Q |
| |
|
|||||||||| |||| ||| | |||||||||||||||||||||| |||| |
|
|
| T |
9351190 |
ataggatggaggtttctcggggtgccaacctagttgggatgtcgatgtt |
9351142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 262 - 318
Target Start/End: Original strand, 14982402 - 14982458
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttg |
318 |
Q |
| |
|
|||||||||| |||| ||||| || ||||| ||||||||||||| |||| ||||||| |
|
|
| T |
14982402 |
ataggatggaagtttctcgaggtgtcaaccaagttgggatgtcgatgttgcctcttg |
14982458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 80; Significance: 2e-37; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 68 - 227
Target Start/End: Complemental strand, 18142953 - 18142794
Alignment:
| Q |
68 |
tttgattgacgactttttgtccagaattgaactttgatttctttcagaacaaatgcggtctgcctaattacagattcccctagtctattggtttccgttt |
167 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||| ||||| ||||||||||| | ||||||| | ||| |
|
|
| T |
18142953 |
tttggttgacgactttacctccagaattgaactttgatttctttcggaacatatgcggtctgcctacttacatattcccctagtatgttggttttctttt |
18142854 |
T |
 |
| Q |
168 |
cctttttctttcttgttttgagagttttagcctaatcctccctctttgtatatattttcc |
227 |
Q |
| |
|
|| ||||||||||||||||||| ||||||| ||| || ||||||||| ||||| ||||| |
|
|
| T |
18142853 |
ccgttttctttcttgttttgagggttttagtctagtcacccctctttgaatatactttcc |
18142794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 262 - 321
Target Start/End: Complemental strand, 13619160 - 13619101
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
13619160 |
ataggatggaggttctccgagttgccaacctagttgggatgttagtgtttcctcttgatg |
13619101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 239 - 305
Target Start/End: Original strand, 15718809 - 15718875
Alignment:
| Q |
239 |
aataatattttgatcttgacagtataggatggatgtttatcgagttgccaacctagttgggatgtcg |
305 |
Q |
| |
|
||||||||||||| ||| ||||| ||||||| |||||||| | ||||||||||||| |||||||| |
|
|
| T |
15718809 |
aataatattttgagtttggcagtagaggatgggggtttatcgggatgccaacctagtttggatgtcg |
15718875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 15894958 - 15894898
Alignment:
| Q |
171 |
ttttctttcttgttttgagagttttagcctaatcctccctctttgtatata-ttttcccccc |
231 |
Q |
| |
|
||||||||||||||||||| ||||||| ||| |||||| || ||||||||| |||||||||| |
|
|
| T |
15894958 |
ttttctttcttgttttgagggttttagtctagtcctccatc-ttgtatatacttttcccccc |
15894898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 323
Target Start/End: Complemental strand, 17678355 - 17678294
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||| || | ||||| |||||||||| ||||||||||| || | |||||||||||| |
|
|
| T |
17678355 |
ataggatggaggtctctcgaggtgccaacctaattgggatgtcgatgatgcctcttgatgtc |
17678294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 323
Target Start/End: Original strand, 20477437 - 20477498
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||| || | ||| | |||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
20477437 |
ataggatggaggtatctcggggtgccaacctagttgggatgtcgatgatgcctcttgatgtc |
20477498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 320
Target Start/End: Complemental strand, 32234475 - 32234434
Alignment:
| Q |
279 |
cgagttgccaacctagttgggatgtcggtgttacctcttgat |
320 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
32234475 |
cgaggtgccaacctagttgggatgtcggtgtgacctcctgat |
32234434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 76; Significance: 4e-35; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 120 - 231
Target Start/End: Complemental strand, 32222656 - 32222545
Alignment:
| Q |
120 |
atgcggtctgcctaattacagattcccctagtctattggtttccgtttcctttttctttcttgttttgagagttttagcctaatcctccctctttgtata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||| | ||| ||| || |||||||||| |
|
|
| T |
32222656 |
atgcggtctgcctaattacagattcccctagtctgttggttttcttttcctttttctttcttgttttgagagttttggtctagtcccccgtctttgtata |
32222557 |
T |
 |
| Q |
220 |
tattttcccccc |
231 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
32222556 |
tatttttccccc |
32222545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 263 - 322
Target Start/End: Complemental strand, 1051382 - 1051323
Alignment:
| Q |
263 |
taggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgt |
322 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1051382 |
taggatggaggtttcccgaggtgccaacctagttgggatgtcggtgttccctcttgatgt |
1051323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 262 - 321
Target Start/End: Original strand, 25760032 - 25760091
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25760032 |
ataggatggaggttttccgaagtgccaacctagttgggatgtcggtgttgcctcttgatg |
25760091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 321
Target Start/End: Complemental strand, 26953995 - 26953958
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26953995 |
tgccaacctagttgggatgtcggtgtttcctcttgatg |
26953958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 284 - 323
Target Start/End: Original strand, 51661714 - 51661753
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
51661714 |
tgccaacctagttgggatgtcgatgttgcctcttgatgtc |
51661753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 321
Target Start/End: Complemental strand, 10623279 - 10623242
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
10623279 |
tgccaacctagttaggatgtcggtgtttcctcttgatg |
10623242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 321
Target Start/End: Original strand, 18517712 - 18517749
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
18517712 |
tgccaacctagttgggatgtcgatgttgcctcttgatg |
18517749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 73; Significance: 3e-33; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 47 - 195
Target Start/End: Complemental strand, 33956618 - 33956470
Alignment:
| Q |
47 |
gatatgcactacagggttcaatttgattgacgactttttgtccagaattgaactttgatttctttcagaacaaatgcggtctgcctaattacagattccc |
146 |
Q |
| |
|
||||||||||||| |||||| |||| |||||| |||| | ||||||||||||||||||||||||| ||| ||| |||||| |||||||||||||||| |
|
|
| T |
33956618 |
gatatgcactacatggttcagtttggttgacggctttaccttcagaattgaactttgatttctttcacgacagatgtggtctgtctaattacagattccc |
33956519 |
T |
 |
| Q |
147 |
ctagtctattggtttccgtttcctttttctttcttgttttgagagtttt |
195 |
Q |
| |
|
||||| | ||| ||| | ||||||||||||||||||||||||| ||||| |
|
|
| T |
33956518 |
ctagtttgttgattttcttttcctttttctttcttgttttgagggtttt |
33956470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 262 - 322
Target Start/End: Original strand, 16290868 - 16290928
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgt |
322 |
Q |
| |
|
|||||||||| |||| || | ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16290868 |
ataggatggaggtttcccggggtgccaacctagttgggatgtcggtgttgcctcttgatgt |
16290928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 284 - 322
Target Start/End: Complemental strand, 24184795 - 24184757
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatgt |
322 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24184795 |
tgccaacctagttgggatgtcggtgttccctcttgatgt |
24184757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 262 - 321
Target Start/End: Original strand, 26657679 - 26657738
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||||||| |||| ||| ||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
26657679 |
ataggatggaggtttcccgaagtgccaacttagttgggatgtcggtgtttcctcttgatg |
26657738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 284 - 322
Target Start/End: Complemental strand, 18036860 - 18036822
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatgt |
322 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
18036860 |
tgccaacatagttgggatgtcggtgtttcctcttgatgt |
18036822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 239 - 305
Target Start/End: Original strand, 18695510 - 18695576
Alignment:
| Q |
239 |
aataatattttgatcttgacagtataggatggatgtttatcgagttgccaacctagttgggatgtcg |
305 |
Q |
| |
|
||||||||||||| ||| ||||| ||||||| |||||||| | ||||||||||||| |||||||| |
|
|
| T |
18695510 |
aataatattttgagtttggcagtagaggatgggggtttatcgggatgccaacctagtttggatgtcg |
18695576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 329
Target Start/End: Original strand, 1046598 - 1046643
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatgtccatctc |
329 |
Q |
| |
|
||||||| ||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
1046598 |
tgccaacatagttgggatgtcggtgttgtctcctgatgtccatctc |
1046643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 323
Target Start/End: Complemental strand, 10568366 - 10568305
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||| |||| ||| | ||||||||||||||| | |||| |||| |||||||||||| |
|
|
| T |
10568366 |
ataggatggaagtttctcggggtgccaacctagttggtaagtcgatgttgcctcttgatgtc |
10568305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 319
Target Start/End: Original strand, 26867471 - 26867527
Alignment:
| Q |
263 |
taggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttga |
319 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||||| || | |||||||| |
|
|
| T |
26867471 |
taggatggaggtttcccgaggtgccaacctagttgggatgtcgatgatgcctcttga |
26867527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 323
Target Start/End: Original strand, 29233375 - 29233435
Alignment:
| Q |
263 |
taggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
||||||||| ||||||| | ||||||| || ||||||||| |||||| |||||||||||| |
|
|
| T |
29233375 |
taggatggaagtttatctggatgccaacttaattgggatgttggtgttgcctcttgatgtc |
29233435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 50 - 142
Target Start/End: Complemental strand, 2040329 - 2040237
Alignment:
| Q |
50 |
atgcactacagggttcaatttgattgacgactttttgtccagaattgaactttgatttctttcagaacaaatgcggtctgcctaattacagat |
142 |
Q |
| |
|
||||| |||| |||| | |||| ||||||||||| |||||||||||||||||||||||||| | | | ||||||| ||||||||||||||| |
|
|
| T |
2040329 |
atgcagtacaaggtttagtttggttgacgactttacttccagaattgaactttgatttctttcgggatagatgcggtttgcctaattacagat |
2040237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 239 - 322
Target Start/End: Complemental strand, 2040167 - 2040084
Alignment:
| Q |
239 |
aataatattttgatcttgacagtataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgt |
322 |
Q |
| |
|
||||||||||||| || || | |||||||| | ||| |||| | ||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
2040167 |
aataatattttgaattttacggcataggatgaaggttcatcgggatgccaacctagttgggatgtcggtgctacctcttcatgt |
2040084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 12163411 - 12163466
Alignment:
| Q |
266 |
gatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||| |||| |||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12163411 |
gatggaggtttcccgaggtgccaacctagttgggatgtcggtgttgcctcttgatg |
12163466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 262 - 323
Target Start/End: Complemental strand, 1538024 - 1537963
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||| |||| | || || |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1538024 |
ataggatggaggtttccctaggtggcaacctagttgggatgtcggtgtttcctcttgatgtc |
1537963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 284 - 323
Target Start/End: Complemental strand, 3997204 - 3997165
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
3997204 |
tgccaacctagttgggatgtcggtgttgcctcctgatgtc |
3997165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 262 - 309
Target Start/End: Original strand, 32021979 - 32022026
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgt |
309 |
Q |
| |
|
|||||||||||| || ||||| ||| |||||||||||||||||||||| |
|
|
| T |
32021979 |
ataggatggatgcttctcgagatgctaacctagttgggatgtcggtgt |
32022026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 321
Target Start/End: Original strand, 28780215 - 28780252
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
28780215 |
tgccaacctagttgggatgtcgatgttgcctcttgatg |
28780252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 279 - 323
Target Start/End: Complemental strand, 15468304 - 15468260
Alignment:
| Q |
279 |
cgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
15468304 |
cgaggtgccaacctagttgggatgtcggtgtggcctcctgatgtc |
15468260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0886 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0886
Description:
Target: scaffold0886; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 262 - 322
Target Start/End: Original strand, 2794 - 2854
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgt |
322 |
Q |
| |
|
|||||||||| |||| ||||| | |||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
2794 |
ataggatggaggtttctcgaggtaccaacctagttgggatgtcgatgttgcctcttgatgt |
2854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0196 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0196
Description:
Target: scaffold0196; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 284 - 323
Target Start/End: Original strand, 798 - 837
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
798 |
tgccaacctagttgggatgtcggtgttgcctcttgatgtc |
837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 262 - 321
Target Start/End: Complemental strand, 1560 - 1501
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||||||| |||| || | ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1560 |
ataggatggaggtttcccggggtgccaacctagttgggatgtcggtgttgcctcttgatg |
1501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 262 - 321
Target Start/End: Complemental strand, 2259463 - 2259404
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||||||| |||| || | ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2259463 |
ataggatggaggtttcccgggatgccaacctagttgggatgtcggtgtttcctcttgatg |
2259404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 284 - 322
Target Start/End: Original strand, 4120553 - 4120591
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatgt |
322 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4120553 |
tgccaacctagttgggatgtcggtgttccctcttgatgt |
4120591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 262 - 323
Target Start/End: Complemental strand, 5781146 - 5781085
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||| |||| ||| | |||||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
5781146 |
ataggatggaagtttctcgggatgccaacctagttgggatgtcgatgttgcctcttaatgtc |
5781085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 321
Target Start/End: Original strand, 15614771 - 15614808
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15614771 |
tgccaacctagttgggatgtcggtgttccctcttgatg |
15614808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 321
Target Start/End: Complemental strand, 21711582 - 21711545
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21711582 |
tgccaacctagttgggatgtcggtgttccctcttgatg |
21711545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 176 - 230
Target Start/End: Complemental strand, 3040781 - 3040727
Alignment:
| Q |
176 |
tttcttgttttgagagttttagcctaatcctccctctttgtatatattttccccc |
230 |
Q |
| |
|
|||||| ||||||| ||||| | ||| ||| |||||||||||||||||||||||| |
|
|
| T |
3040781 |
tttcttcttttgagggttttggtctagtcccccctctttgtatatattttccccc |
3040727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 323
Target Start/End: Complemental strand, 28682823 - 28682762
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||| || | ||| | |||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
28682823 |
ataggatggaggtctctcgggatgccaacctagttgggatgtcgatgatgcctcttgatgtc |
28682762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 24122975 - 24123011
Alignment:
| Q |
287 |
caacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
24122975 |
caacctagttgagatgtcggtgtttcctcttgatgtc |
24123011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0437 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0437
Description:
Target: scaffold0437; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 284 - 322
Target Start/End: Original strand, 11448 - 11486
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatgt |
322 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11448 |
tgccaacctagttgggatgtcggtgttccctcttgatgt |
11486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0437; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 323
Target Start/End: Complemental strand, 14396 - 14335
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||| || | ||| | |||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
14396 |
ataggatggaggtctctcgggatgccaacctagttgggatgtcgatgatgcctcttgatgtc |
14335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 321
Target Start/End: Original strand, 2328 - 2365
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2328 |
tgccaacctagttgggatgtcggtgttccctcttgatg |
2365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 262 - 323
Target Start/End: Original strand, 103718 - 103779
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||| ||| ||| | |||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
103718 |
ataggatggagatttctcggggtgccaacctagttgggatgtcgatgttgcctcttgatgtc |
103779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 321
Target Start/End: Complemental strand, 34657957 - 34657920
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34657957 |
tgccaacctagttgggatgtcggtgtttcctcttgatg |
34657920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 284 - 323
Target Start/End: Complemental strand, 44673719 - 44673680
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
44673719 |
tgccaacctagttgggatgtcgatgttgcctcttgatgtc |
44673680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 278 - 323
Target Start/End: Original strand, 7190102 - 7190147
Alignment:
| Q |
278 |
tcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
||||| |||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
7190102 |
tcgaggtgccaacctagttgggatgtcgatgatgcctcttgatgtc |
7190147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 262 - 322
Target Start/End: Complemental strand, 1924720 - 1924660
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgt |
322 |
Q |
| |
|
|||||||||| || | ||| | |||||||||||||||||||||| || ||| ||||||||| |
|
|
| T |
1924720 |
ataggatggaggtgtctcggggtgccaacctagttgggatgtcgatgatacatcttgatgt |
1924660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 321
Target Start/End: Complemental strand, 19054429 - 19054392
Alignment:
| Q |
284 |
tgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19054429 |
tgccaacctagttgggatgtcggtgtttcctcttgatg |
19054392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 10423863 - 10423808
Alignment:
| Q |
266 |
gatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||| |||| ||| | |||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
10423863 |
gatggaggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttgatg |
10423808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 262 - 321
Target Start/End: Complemental strand, 34528985 - 34528926
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||||||| |||| || | |||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
34528985 |
ataggatggaggtttcccggggtgccaacctagttgggatgtcgctgtttcctcttgatg |
34528926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 287 - 321
Target Start/End: Complemental strand, 10032129 - 10032095
Alignment:
| Q |
287 |
caacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
10032129 |
caacctagttgggatgtcggtgtttcctcttgatg |
10032095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 229
Target Start/End: Complemental strand, 16816374 - 16816328
Alignment:
| Q |
183 |
ttttgagagttttagcctaatcctccctctttgtatatattttcccc |
229 |
Q |
| |
|
||||||| ||||| ||||| ||||||||| ||||||||||||||||| |
|
|
| T |
16816374 |
ttttgagggttttggcctagtcctccctcgttgtatatattttcccc |
16816328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 285 - 321
Target Start/End: Complemental strand, 16816277 - 16816241
Alignment:
| Q |
285 |
gccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
16816277 |
gccaacctagttgggatgttggtgtttcctcttgatg |
16816241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 262 - 321
Target Start/End: Original strand, 4451 - 4510
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatg |
321 |
Q |
| |
|
|||||||||| || | ||||| ||||||||||||||||||||| || |||||||||||| |
|
|
| T |
4451 |
ataggatggaggtctctcgaggtgccaacctagttgggatgtcaatgatacctcttgatg |
4510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 239 - 305
Target Start/End: Original strand, 67366 - 67432
Alignment:
| Q |
239 |
aataatattttgatcttgacagtataggatggatgtttatcgagttgccaacctagttgggatgtcg |
305 |
Q |
| |
|
||||||||||||| ||| ||||| ||||||| |||||||| | ||||||||||||| |||||||| |
|
|
| T |
67366 |
aataatattttgagtttggcagtagaggatgggggtttatcgggatgccaacctagtttggatgtcg |
67432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 322
Target Start/End: Complemental strand, 36732 - 36678
Alignment:
| Q |
268 |
tggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgt |
322 |
Q |
| |
|
|||| |||| ||||| | |||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
36732 |
tggaggtttctcgaggtaccaacctagttgggatgtcgatgttgcctcttgatgt |
36678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 323
Target Start/End: Complemental strand, 21940 - 21879
Alignment:
| Q |
262 |
ataggatggatgtttatcgagttgccaacctagttgggatgtcggtgttacctcttgatgtc |
323 |
Q |
| |
|
|||||||||| || | ||| | |||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
21940 |
ataggatggaggtctctcgggatgccaacctagttgggatgtcgatgatgcctcttgatgtc |
21879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University