View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7861_low_42 (Length: 254)
Name: NF7861_low_42
Description: NF7861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7861_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 237
Target Start/End: Complemental strand, 17867383 - 17867162
Alignment:
| Q |
15 |
gacatcacttgtgagatctgtcatcaggtatgctgttttgtatgataactttaattttcctaatcagttatctttttgtcggtgatggaaaataatgtga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17867383 |
gacatcacttgtgagatctgtcatcaggtatgctgttttgtatgataactttaattttcctaatcagttatctttttgtcggtgatggaaaataatgtga |
17867284 |
T |
 |
| Q |
115 |
atacttannnnnnnaaaagtggctagttttattagagtctatctcttgtttaataccctcttttcttcgcatcgtatgcatacgtgcaggcatctaattg |
214 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17867283 |
atgcttatttttt-aaaagtggctagttttattagagtctatctcttgtttaataccctctttccttcgcatcgtatgcatacgtgcaggcatctaattg |
17867185 |
T |
 |
| Q |
215 |
tttttggcctgccgcccactgat |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
17867184 |
tttttggcctgccgcccactgat |
17867162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University