View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7861_low_43 (Length: 251)
Name: NF7861_low_43
Description: NF7861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7861_low_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 34779255 - 34779471
Alignment:
| Q |
18 |
caacatagtgtaacaattaacataattatgcagtatagactccaaaagaaattagatattataaacatgcatggtggaataggaaatatttaccaaatgt |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34779255 |
caacatactgtaacaattaacataattatgcagtacagactccaaaagaaattagatattataaacatgcatggtggaataggaaatatttaccaaatgt |
34779354 |
T |
|
| Q |
118 |
gttgtaagtgcatgtgattaagttagccatttatatcgcgtcagagaacacagccctttgaaattttgctgacagcttttggtaggactgaaattctgag |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34779355 |
gttgtaagtgcatgtgattaagttaaccatttatatcgcatcagagaacacggccctttgaaattttgctgacagcttttggtaggactgaaattctgag |
34779454 |
T |
|
| Q |
218 |
ggctgaacctgtttgat |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34779455 |
ggctgaacctgtttgat |
34779471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 161 - 230
Target Start/End: Complemental strand, 34682979 - 34682910
Alignment:
| Q |
161 |
gagaacacagccctttgaaattttgctgacagcttttggtaggactgaaattctgagggctgaacctgtt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||| ||||| ||||||||| |||| |
|
|
| T |
34682979 |
gagaacacagccctttgaaattttgctgacaacttttgataggactgagtttctgtgggctgaacttgtt |
34682910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University