View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7861_low_44 (Length: 247)
Name: NF7861_low_44
Description: NF7861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7861_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 34658355 - 34658123
Alignment:
| Q |
1 |
tttttaatagaacatgttagtattttcacccttgtcaagattcgaaatatgaatttttaactcttttatcccttaactcaaccaagtgagttgcccaacg |
100 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
34658355 |
tttttaatagaatatgttagtattttcttccttgtcaagattcgaaatatgaatttttaactcttttatcctttaactcaaccaagtgagttacccaacg |
34658256 |
T |
|
| Q |
101 |
ccgttcatttaaacaaacttgatgggagattagtgaaatttctccaacttataaatgnnnnnnnnnnnnnnnnnataaatagaatgaatatgcgtgttat |
200 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
34658255 |
ccgttcatttaaacaaatttgagggaagattagtgcaatttctccaacttataaatgttttttattttatttttataaatagaatgaatatgtgtgttat |
34658156 |
T |
|
| Q |
201 |
ttaaacatactttttgggatgtcagaagttagt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34658155 |
ttaaacatactttttgggatgtcagaagttagt |
34658123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 14 - 97
Target Start/End: Complemental strand, 18722282 - 18722199
Alignment:
| Q |
14 |
atgttagtattttcacccttgtcaagattcgaaatatgaatttttaactcttttatcccttaactcaaccaagtgagttgccca |
97 |
Q |
| |
|
||||||| |||||| |||||| || ||||| || |||| ||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
18722282 |
atgttagcattttctcccttgccaggattcaaaccctgaacctttaactctttaatcccttagctcaaccaagtgagttaccca |
18722199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University