View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7862_high_9 (Length: 239)
Name: NF7862_high_9
Description: NF7862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7862_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 41319780 - 41319545
Alignment:
| Q |
1 |
atccaggattgtatggctcagatgatagaatgcatgcttgtatggctgaactcggtgttccactcactaaagaaacggggtttcaccaggtgagtgattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41319780 |
atccaggattgtatggctcagatgatagaatgcatgcttgtatggctgaactcggtgttccactcactaaagaaacggggtttcaccaggtgagtgattt |
41319681 |
T |
 |
| Q |
101 |
aactcggtgnnnnnnnngatttgtgctgtcagtgtcttatcatgaaacgtggttcacttattattacactgtctgtttattttgtggacccgttttggtt |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41319680 |
aactcggtgttttttt-gatttgtgctgtcagtgtcttatcatgaaacgtggttcacttattattacactgtctgtttattttgtggacccgttttggtt |
41319582 |
T |
 |
| Q |
201 |
cggtgggtgtgaaactgcttttctactttgcaatttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41319581 |
cggtgggtgtgaaactgcttttctactttgcaatttc |
41319545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 2619450 - 2619540
Alignment:
| Q |
1 |
atccaggattgtatggctcagatgatagaatgcatgcttgtatggctgaactcggtgttccactcactaaagaaacggggtttcaccaggt |
91 |
Q |
| |
|
|||||||| | ||||| || |||||| ||||||| ||||||||||||||||| ||||||||||| || || |||| || ||||||||||| |
|
|
| T |
2619450 |
atccaggactttatggttctgatgatcgaatgcaagcttgtatggctgaacttggtgttccacttacaaaggaaatcggttttcaccaggt |
2619540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 29613048 - 29612989
Alignment:
| Q |
8 |
attgtatggctcagatgatagaatgcatgcttgtatggctgaactcggtgttccactcac |
67 |
Q |
| |
|
||||||||| ||||||||||| || || |||||||||||||| || |||||||| ||||| |
|
|
| T |
29613048 |
attgtatgggtcagatgataggattcaagcttgtatggctgagcttggtgttcctctcac |
29612989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 91
Target Start/End: Complemental strand, 22776418 - 22776348
Alignment:
| Q |
21 |
gatgatagaatgcatgcttgtatggctgaactcggtgttccactcactaaagaaacggggtttcaccaggt |
91 |
Q |
| |
|
|||||||||||||| ||||| |||||||| || ||||||||| | || || ||| | |||||||||||||| |
|
|
| T |
22776418 |
gatgatagaatgcaagcttgcatggctgagctaggtgttccattaaccaaggaagcagggtttcaccaggt |
22776348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University