View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7862_low_7 (Length: 268)
Name: NF7862_low_7
Description: NF7862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7862_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 11 - 201
Target Start/End: Complemental strand, 963335 - 963146
Alignment:
| Q |
11 |
agaacctgtgtttgggagagactctaagtcctaaaacataagctagttttacataagctgaattccctcttgtaactgttttcacacaaccccttatcac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
963335 |
agaacctgtgtttgggagagactctaagtcctaaaacataagctagttttacataagctgaattccctcttgtaactgttttcacacaaccccttatcac |
963236 |
T |
 |
| Q |
111 |
tccaacaacttctccttcttctccatattctgcaacctgtttggaacaaatattaccttgatcagtccatatatcaaactgtgaaactact |
201 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
963235 |
tccagcaacttctccttcttcttcatattctgcaacctgtttggaacaaatattacattgattagtcca-atatcaaactgtgaaactact |
963146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 210 - 268
Target Start/End: Complemental strand, 963056 - 962998
Alignment:
| Q |
210 |
tattcaacactaaaacataatgtcgcattaggtatacatcaatatagtgtgtcaactct |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
963056 |
tattcaacactaaaacataatgtcgcattagatatacatcaatatagtgtgtcaactct |
962998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University