View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_high_35 (Length: 296)
Name: NF7863_high_35
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 34 - 170
Target Start/End: Original strand, 50325050 - 50325186
Alignment:
| Q |
34 |
gttgatcatgtattccttgatttcttccagataggagcagttcaagctgtgtcccgtgaagcctatttcacggttattgaaggtgcactgcaatacaatt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50325050 |
gttgatcatgtattccttgatttcttccagataggagcagttcaagctgtgtcccgtgaagcctatttcacggttattgaaggtgcactgcaatacaatt |
50325149 |
T |
 |
| Q |
134 |
cccccttaggccttaacacttcttttctcacttttat |
170 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50325150 |
cccccttgggccttaacacttcttttctcacttttat |
50325186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 242 - 277
Target Start/End: Original strand, 50325208 - 50325243
Alignment:
| Q |
242 |
atattgatattgatatggcaacccacatttagtgtg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
50325208 |
atattgatattgatatggcaacccacatttagtgtg |
50325243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University