View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_high_50 (Length: 236)
Name: NF7863_high_50
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_high_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 15 - 223
Target Start/End: Original strand, 36826817 - 36827025
Alignment:
| Q |
15 |
gacatcattgtgcaccatatatttggtgtggtcaaaacactatggacagggtaagtttcttcatgcattttaagttgatataatagtataaaattatttg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36826817 |
gacatcattgtgcaccatatatttggtgtggtcaaaacatcatggacagggtaagtttctttatgcattttaagttgatataatagtataaaattatttg |
36826916 |
T |
|
| Q |
115 |
aatatgaaaaagagtgatgttcttgttgctgttaattcttattctccattagagagcagaagtctcacataaaagaacctgaaaagaaacaggaggagtt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36826917 |
aatatgaaaaagagtgatgttcttgttgctgttaattcttattctccattagagagcagaagtctcacataaaagaacctgaaaagaaacaggaggagtt |
36827016 |
T |
|
| Q |
215 |
catgatgtc |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
36827017 |
catgatgtc |
36827025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University