View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_high_52 (Length: 233)
Name: NF7863_high_52
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_high_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 21078367 - 21078597
Alignment:
| Q |
1 |
ccacatccttcttccctgtctccttcttggagcaacagagtgatatgtgtgatcttgatcagtttcaagtggatgatgcaccaccagttattaacttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21078367 |
ccacatccttcttccctgtctccttcttggagcaacagagtgatatgtgtgatcttgatcagtttcaagtggatgatgcaccaccagttattaacttatc |
21078466 |
T |
 |
| Q |
101 |
caaatattttcctccaagttcccataaaaagaaaaagcgcagcatcgtgagaagaaatatgattgatcatgaacttcttaatgcagcacatatactcttg |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21078467 |
caaatatttgcctccaagttcccataaaaagaaaaaacgcagcatcgtgagaagaaatatgattgatcatgaacttcttaatgcagcacatatactcttg |
21078566 |
T |
 |
| Q |
201 |
gatatgtctcgtggtggtggtggtgatgatg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21078567 |
gatatgtctcgtggtggtggtggtgatgatg |
21078597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 3073780 - 3073724
Alignment:
| Q |
153 |
agaaatatgattgatcatgaacttcttaatgcagcacatatactcttggatatgtct |
209 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| |||| ||| |||||| ||||||||| |
|
|
| T |
3073780 |
agaaatatcattgatcatgaacatcttaatggagcatatacactcttcgatatgtct |
3073724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 27732144 - 27732088
Alignment:
| Q |
153 |
agaaatatgattgatcatgaacttcttaatgcagcacatatactcttggatatgtct |
209 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| |||||| | |||||| |||||||| |
|
|
| T |
27732144 |
agaaatatcattgatcatgaacatcttaatggagcacaaacactcttcaatatgtct |
27732088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University