View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_high_53 (Length: 230)
Name: NF7863_high_53
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_high_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 30841703 - 30841916
Alignment:
| Q |
1 |
attcttcttcttcactcattctcagatccataaccatgaaaacttcttcagaaactccttcgcaatcttcacacaacaccagatccaaaaaacccaatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30841703 |
attcttcttcttcactcattctcagatccataaccatgaaaacttcttcagaaactccttcacaatcttcacacaacaccagatccaaaaaacccaatct |
30841802 |
T |
 |
| Q |
101 |
tcctagctcaaaatctttattcaaagatccaattgaactaaccacaaaaaccccagaaaaatcactggagaagccaccaccgatgcgaacccgcaatcgc |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30841803 |
tcgtagctcaaaatctttattcaaagatccaattgaactaaccacaaaaaccccagaaaaatcactggagaagccaccaccgatgcgaacccgcaatcgc |
30841902 |
T |
 |
| Q |
201 |
ggtgtcgcactttc |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30841903 |
ggtgtcgcactttc |
30841916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University