View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_high_54 (Length: 225)
Name: NF7863_high_54
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_high_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 7725871 - 7725679
Alignment:
| Q |
16 |
acagcaactctgtatttttgagggtcctttttggtatgtcttctgctagtgtgaatatatataccatttttgcttcttcnnnnnnnnnn-gtcacatttc |
114 |
Q |
| |
|
||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||| || ||| |||||| |
|
|
| T |
7725871 |
acagcaactct--atttttgagcgtcctctttggtatgtcttctgctagtgtgaatatatatatcatttttgctttttaaaaaaaaaaaagtcgcatttc |
7725774 |
T |
 |
| Q |
115 |
caatatatgcatattatgtaggtatgatgtgtttgttaatcagatgaacacttcatagatcatggttgatagatgatagttatcattattgcattca |
211 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7725773 |
caatatatgcatattaagtaggtatgatgtgtttgttaatcagatga--acttcatagatcatggttgataaatgatagttatcattattgcattca |
7725679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 105 - 209
Target Start/End: Complemental strand, 7736393 - 7736284
Alignment:
| Q |
105 |
gtcacatttccaatatatgcatattat-------gtaggtatgatgtgtttgttaatcagatgaacacttcatagatcatggttgatagatgatagttat |
197 |
Q |
| |
|
|||||||||||||||||||||||||| | || ||||||||||| |||||||||||||| |||||||||||| ||||| | ||||||||| | |
|
|
| T |
7736393 |
gtcacatttccaatatatgcatattaatgcaatagcagttatgatgtgttgcttaatcagatgaac--ttcatagatcatagttgagaaatgatagtttt |
7736296 |
T |
 |
| Q |
198 |
cattattgcatt |
209 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
7736295 |
cattcttgcatt |
7736284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 64 - 93
Target Start/End: Original strand, 21394044 - 21394073
Alignment:
| Q |
64 |
gtgtgaatatatataccatttttgcttctt |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21394044 |
gtgtgaatatatataccatttttgcttctt |
21394073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University