View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_low_102 (Length: 236)
Name: NF7863_low_102
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_low_102 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 35881058 - 35880832
Alignment:
| Q |
1 |
gtactacattcatcacccagattggtctatcaatgagagatgcggcaaatctgaaaaataagacaatcggtatcaatttgactgaagtttggtggaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35881058 |
gtactacattcatcacccagattggtctatcaataagagatgcggcaaatctgaaaaataagacaatcggtatcaatttgactgaagtttggtggaaact |
35880959 |
T |
 |
| Q |
101 |
agccaacttcagttgacacaagtgttagataagattggcatcaacaaatccacacaaagttcaacnnnnnnnnctaatcttttacaaagtatatacttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35880958 |
agccaacttcagttgacacaagtgttagataagattgacatcaataaatccacacaaagttcaacaaaaaaaactaatcttttacaaagtatatacttta |
35880859 |
T |
 |
| Q |
201 |
ccctgcataaccagcattgatgtccat |
227 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
35880858 |
ccctgcataaccagcattcatgtccat |
35880832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 32096394 - 32096451
Alignment:
| Q |
1 |
gtactacattcatcacccagattggtctatcaatgagagatgcggcaaatctgaaaaa |
58 |
Q |
| |
|
||||||||||||||||||| | ||||| ||| || |||| ||| |||||||||||||| |
|
|
| T |
32096394 |
gtactacattcatcacccacaatggtcgatcgataagagctgcagcaaatctgaaaaa |
32096451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University