View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_low_105 (Length: 234)
Name: NF7863_low_105
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_low_105 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 33507199 - 33506993
Alignment:
| Q |
16 |
attatgtccaatgccaattactgagtaaaatcattttactcgtgagtggttgatgctaatgcttgatttcaggatcgttgaccgaaatatccaagggtgc |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33507199 |
attatgtccaatgccaattactgaataaaatcattttactcgtgagtggttgatgctaatgcttgatttcaggatcgttgaccgaaatatccaagggtgc |
33507100 |
T |
 |
| Q |
116 |
tgtgggaaaactgctacgtcgtgctaacaaaggtggcaattctaagaaaaagaccacggttagttccctgtaactccccgttgcttttacataatttgtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33507099 |
tgtgggaaaactgctacgtcgtgctaacaaaggtggcacttctaagaaaaagaccacggttagttccctgtaactccccgttgcttttacataatttgtt |
33507000 |
T |
 |
| Q |
216 |
ctgttca |
222 |
Q |
| |
|
||||||| |
|
|
| T |
33506999 |
ctgttca |
33506993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University