View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7863_low_108 (Length: 225)

Name: NF7863_low_108
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7863_low_108
NF7863_low_108
[»] chr7 (2 HSPs)
chr7 (16-211)||(7725679-7725871)
chr7 (105-209)||(7736284-7736393)
[»] chr4 (1 HSPs)
chr4 (64-93)||(21394044-21394073)


Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 7725871 - 7725679
Alignment:
16 acagcaactctgtatttttgagggtcctttttggtatgtcttctgctagtgtgaatatatataccatttttgcttcttcnnnnnnnnnn-gtcacatttc 114  Q
    |||||||||||  ||||||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||| ||            ||| ||||||    
7725871 acagcaactct--atttttgagcgtcctctttggtatgtcttctgctagtgtgaatatatatatcatttttgctttttaaaaaaaaaaaagtcgcatttc 7725774  T
115 caatatatgcatattatgtaggtatgatgtgtttgttaatcagatgaacacttcatagatcatggttgatagatgatagttatcattattgcattca 211  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||  |||||||||||||||||||||| |||||||||||||||||||||||||    
7725773 caatatatgcatattaagtaggtatgatgtgtttgttaatcagatga--acttcatagatcatggttgataaatgatagttatcattattgcattca 7725679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 105 - 209
Target Start/End: Complemental strand, 7736393 - 7736284
Alignment:
105 gtcacatttccaatatatgcatattat-------gtaggtatgatgtgtttgttaatcagatgaacacttcatagatcatggttgatagatgatagttat 197  Q
    ||||||||||||||||||||||||||        | || |||||||||||  ||||||||||||||  |||||||||||| ||||| | ||||||||| |    
7736393 gtcacatttccaatatatgcatattaatgcaatagcagttatgatgtgttgcttaatcagatgaac--ttcatagatcatagttgagaaatgatagtttt 7736296  T
198 cattattgcatt 209  Q
    |||| |||||||    
7736295 cattcttgcatt 7736284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 64 - 93
Target Start/End: Original strand, 21394044 - 21394073
Alignment:
64 gtgtgaatatatataccatttttgcttctt 93  Q
    ||||||||||||||||||||||||||||||    
21394044 gtgtgaatatatataccatttttgcttctt 21394073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University