View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_low_113 (Length: 221)
Name: NF7863_low_113
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_low_113 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32928392 - 32928615
Alignment:
| Q |
1 |
agaaatggcgttaggaaaacagggtgaacccattagcattgctgactgtaacggagttggacccatgttgtattgtgtgatnnnnnnnnnnnnnnnnn-- |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32928392 |
agaaatggcgttaggaaaacagggtgaacccattagcattgctgactgtaacggagttggacccatgttgtattgtgtgaagaagaagaagaagaagaag |
32928491 |
T |
 |
| Q |
99 |
-tgactagggttcgaatccctccttgaactgtaaattttaatctattaataattctattttttcagcatgatcgcgctcgctcgctacgatgaagaaaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || ||||||||||||||||||||||| | ||| |
|
|
| T |
32928492 |
atgactagggttcgaatccctccttgaactgtaaattttaatctattaataattcaattttttcagtgtgttcgcgctcgctcgctacgatgaaaacaat |
32928591 |
T |
 |
| Q |
198 |
atatattcagaaaacgagaaaaca |
221 |
Q |
| |
|
|||||| ||||||||||||||||| |
|
|
| T |
32928592 |
atatatacagaaaacgagaaaaca |
32928615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 4 - 71
Target Start/End: Complemental strand, 1483335 - 1483268
Alignment:
| Q |
4 |
aatggcgttaggaaaacagggtgaacccattagcattgctgactgtaacggagttggacccatgttgt |
71 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1483335 |
aatggagtttggaaaacaaggtgaacccattagcatcgctgactgtaacggagttggacccatgttgt |
1483268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University