View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_low_114 (Length: 218)
Name: NF7863_low_114
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_low_114 |
 |  |
|
| [»] chr7 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 23466309 - 23466526
Alignment:
| Q |
1 |
caaattatgattgcatttgtttgtattttgccgcaatatcaaggtttttnnnnnnnttgcgaccccaagagcattttagaaccatggttaagagtaatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23466309 |
caaattatgattgcatttgtttgtattttgccgcaatatcaaggtttttaaaaaaattgcgaccccaagagcattttagaaccatggttaagagtaatta |
23466408 |
T |
 |
| Q |
101 |
ataaataatagcagcttttatttgttcttaaccatggttctaaaatgtttttgcagtcacaattttgtttataaccttgatattgtggtaaaatacaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23466409 |
ataaataatagcagcttttatttgttcttaaccatggttctaaaatgtttttgcagtcacaattttgtttataaccttgatattgtggtaaaatacaaac |
23466508 |
T |
 |
| Q |
201 |
aattgacctgaccaaaaa |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
23466509 |
aattgacctgaccaaaaa |
23466526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 23456940 - 23457154
Alignment:
| Q |
1 |
caaattatgattgcatttgtttgtattttgccgcaatatcaaggtttttnnnnnnnttgcgaccccaagagcattttagaaccatggttaagagtaatta |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23456940 |
caaattatgattacatttgtttgtattttgccgcaatatcaaggtttttaaaaaaattgcgaccccaagagcattttagaaccatggttaagagtaatta |
23457039 |
T |
 |
| Q |
101 |
ataaataatagcagcttttatttgttcttaaccatggttctaaaatgtttttgcagtcacaattttgtttataaccttgatattgtggtaaaatacaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23457040 |
ataaataatagcagcttttatttgttcttaaccatggttctaaaatgtttttgcagtcacaattttgtttataaccttgatattgtggtaaaatacaaac |
23457139 |
T |
 |
| Q |
201 |
aattgacctgaccaa |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
23457140 |
aattgacctgaccaa |
23457154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 2 - 202
Target Start/End: Original strand, 23536222 - 23536422
Alignment:
| Q |
2 |
aaattatgattgcatttgtttgtattttgccgcaatatcaaggtttttnnnnnnnttgcgaccccaagagcattttagaaccatggttaagagtaattaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||| |||| ||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23536222 |
aaattatgattgcatttgtttgtatttcgccgcaatttcaaggtttttaaaaaagttgcaacctcaagagcattttagaaccatagttaagagtaattaa |
23536321 |
T |
 |
| Q |
102 |
taaataatagcagcttttatttgttcttaaccatggttctaaaatgtttttgcagtcacaattttgtttataaccttgatattgtggtaaaatacaaaca |
201 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
23536322 |
taaataatagcagcttttatttgctcttaaccatggttctaaaatgcttttgcgatcacaattttgtttataactttaatattgcggtaaaatacaaaca |
23536421 |
T |
 |
| Q |
202 |
a |
202 |
Q |
| |
|
| |
|
|
| T |
23536422 |
a |
23536422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 126 - 202
Target Start/End: Complemental strand, 23457032 - 23456956
Alignment:
| Q |
126 |
tcttaaccatggttctaaaatgtttttgcagtcacaattttgtttataaccttgatattgtggtaaaatacaaacaa |
202 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||| ||||||| || | ||||||||||||| || ||||||||||||| |
|
|
| T |
23457032 |
tcttaaccatggttctaaaatgctcttggggtcgcaatttttttaaaaaccttgatattgcggcaaaatacaaacaa |
23456956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 126 - 202
Target Start/End: Complemental strand, 23466401 - 23466325
Alignment:
| Q |
126 |
tcttaaccatggttctaaaatgtttttgcagtcacaattttgtttataaccttgatattgtggtaaaatacaaacaa |
202 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||| ||||||| || | ||||||||||||| || ||||||||||||| |
|
|
| T |
23466401 |
tcttaaccatggttctaaaatgctcttggggtcgcaatttttttaaaaaccttgatattgcggcaaaatacaaacaa |
23466325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University