View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_low_115 (Length: 217)
Name: NF7863_low_115
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_low_115 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 20 - 197
Target Start/End: Original strand, 38588365 - 38588542
Alignment:
| Q |
20 |
tatgggacaaccagttctccctacattgacactacataatttggttgagctgtggcttgattcaacagcgtccacatcacaccgaattccggctattatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38588365 |
tatgggacaaccagttctccctacattgacactacataatttggttgagctgtggcttgattcaacagcgtccacatcacaccgaattccggctattatt |
38588464 |
T |
|
| Q |
120 |
ggatcctcagcaaaggattttgtcatggtccttgcttatgcccggaaatctccacacccttgatcatggttacccccc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38588465 |
ggatcctcagcaaaggattttgtcatggtccttgcttatgcccggaaatctccacgcccttgatcatggttacccccc |
38588542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University