View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_low_118 (Length: 214)
Name: NF7863_low_118
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_low_118 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 16 - 214
Target Start/End: Complemental strand, 46865098 - 46864901
Alignment:
| Q |
16 |
atgggggagaaggcacgtgttgaatttcaatgtatccaacccaacacttcgctatctgaacccaaaagtgcgttccacatgcacaaagtaacatattttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46865098 |
atgggggagaaggcacgtgttgaatttcaatgtatccaacccaacacttcgctatctgaacccaaaagtgcgttccacatgcacaaa-taacatattttg |
46865000 |
T |
|
| Q |
116 |
aatagaaattcggtgacattagagtgctaatgacattagccgaccacaatatcacaagtgtgcatctttatgaatgagagagaagaaaatcatgatttt |
214 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||| || ||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46864999 |
gatagcaattcggtgacattggagtgctaatgacattagccgatcataatgtcacaagtgtgcatctttatgaatgagagagaagaaagtcatgatttt |
46864901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University