View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7863_low_80 (Length: 281)

Name: NF7863_low_80
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7863_low_80
NF7863_low_80
[»] chr8 (3 HSPs)
chr8 (1-57)||(2179660-2179716)
chr8 (41-136)||(2181585-2181680)
chr8 (62-139)||(2162022-2162099)


Alignment Details
Target: chr8 (Bit Score: 57; Significance: 7e-24; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 2179660 - 2179716
Alignment:
1 tcacttcccagttaacaatgataagcgataaaatcaagatgccccaaccgatgaaaa 57  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2179660 tcacttcccagttaacaatgataagcgataaaatcaagatgccccaaccgatgaaaa 2179716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 41 - 136
Target Start/End: Original strand, 2181585 - 2181680
Alignment:
41 gccccaaccgatgaaaacgatgatagcagcagtccacgaaacaagactcacaactataaacgatgttgcagtcgatagcagaagtatgaatatgat 136  Q
    ||||||| | || |||| ||||||||||||  |||||||||||||||||||  ||||||||||| ||||||| |||||||||| ||||||||||||    
2181585 gccccaaacaatcaaaatgatgatagcagcgatccacgaaacaagactcacttctataaacgatattgcagttgatagcagaattatgaatatgat 2181680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 139
Target Start/End: Original strand, 2162022 - 2162099
Alignment:
62 gatagcagcagtccacgaaacaagactcacaactataaacgatgttgcagtcgatagcagaagtatgaatatgatccc 139  Q
    ||||| |||||||  |||||||||| ||||  ||||||| ||| ||||| | ||||| ||||||||||||| ||||||    
2162022 gatagtagcagtcgtcgaaacaagaatcacttctataaatgatattgcacttgatagaagaagtatgaataagatccc 2162099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University